Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU063491

Sigma-Aldrich

MISSION® esiRNA

targeting human ELAVL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
En este momento no podemos mostrarle ni los precios ni la disponibilidad

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGTCACCAATGTGAAAGTGATCCGCGACTTCAACACCAACAAGTGCAAAGGGTTTGGCTTTGTGACCATGACAAACTATGAAGAAGCCGCGATGGCCATAGCCAGCCTGAACGGCTACCGCCTGGGGGACAAAATCTTACAGGTTTCCTTCAAAACCAACAAGTCCCACAAATAACTCGCTCATGCTTTTTTTTGTACGGAATAGATAATTAAGAGTGAAGGAGTTGAAACTTTTCTTGTTAGTGTACAACTCATTTTGCGCCAATTTTCACAAGTGTTTGTCTTTGTCTGAATGAGAAGTGAGAAGGTTTTTATACTCTGGGATGCAACCGACATGTTCAAATGTTTGAAATCCCACAATGTTAGACCAATCTTAAGTTTCGTAAGTTATTTCCTTTAAGATATATATTAAACAGAAATCTAAGTAGAACTGCATTGACTAACCAGTCCCTCTGGATGGTGGTGAACCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kotb Abdelmohsen et al.
RNA biology, 14(3), 361-369 (2017-01-13)
HuR influences gene expression programs and hence cellular phenotypes by binding to hundreds of coding and noncoding linear RNAs. However, whether HuR binds to circular RNAs (circRNAs) and impacts on their function is unknown. Here, we have identified en masse
Guillaume Gauchotte et al.
The Journal of pathology, 242(4), 421-434 (2017-05-12)
HuR regulates cytoplasmic mRNA stability and translatability, and the HuR expression level has been shown to correlate with poor disease outcome in several cancer types; however, the prognostic value and potential pro-oncogenic properties of HuR in meningioma remain unclear. Thus
Aya Yanagawa-Matsuda et al.
Oncology reports, 41(2), 954-960 (2018-11-16)
AU-rich elements (AREs) are RNA elements that enhance the rapid decay of mRNA. The fate of ARE-mRNA is controlled by ARE-binding proteins. HuR, a member of the embryonic lethal abnormal vision (ELAV) family of RNA-binding proteins, is involved in the
Sun Kyoung Lee et al.
Scientific reports, 7(1), 9610-9610 (2017-08-31)
Breast cancer mainly spreads to bone, causing decreased survival of patient. Human antigen R (HuR) and chemokines are important molecules associated with mRNA stability and cell-cell interaction in cancer biology. Here, HuR knockdown inhibited bone metastasis and osteolysis of metastatic
Shuran Li et al.
Science China. Life sciences, 60(6), 617-626 (2017-06-25)
APOBEC3 protein families, a DNA cytidine deaminase, were up-regulated in multiple tumors. However, the relationship between Hepatocellular carcinoma (HCC) and APOBEC3B (A3B) remains unknown. It has been confirmed that interleukin-6 (IL-6) has significant impacts on oncogenesis of HCC. Here, we

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico