Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU061031

Sigma-Aldrich

MISSION® esiRNA

targeting human SRPK1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCTGTTGAAAGACCCTTGAAAGAGAACCCACCTAATAAAATGACCCAAGAAAAACTTGAAGAGTCAAGTACCATTGGCCAGGATCAAACGCTTATGGAACGTGATACAGAGGGTGGTGCAGCAGAAATTAATTGCAATGGAGTGATTGAAGTCATTAATTATACTCAGAACAGTAATAATGAAACATTGAGACATAAAGAGGATCTACATAATGCTAATGACTGTGATGTCCAAAATTTGAATCAGGAATCTAGTTTCCTAAGCTCCCAAAATGGAGACAGCAGCACATCTCAAGAAACAGACTCTTGTACACCTATAACATCTGAGGTGTCAGACACCATGGTGTGCCAGTCTTCCTCAACTGTAGGTCAGTCATTCAGTGAACAACACATTAGCCAACTTCAAGAAAGCATTCGGG

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhengbu Liao et al.
Molecular neurobiology, 54(3), 1818-1824 (2016-02-19)
Up to now, the serine-arginine protein kinase 1 (SRPK1) has been suggested as an important signal mediator, which is implicated in the development of cancers. Unfortunately, some molecular pathways in SRPK1-mediated epithelial-mesenchymal transition (EMT) in human spinal glioblastoma have been
Parmanand Malvi et al.
Oncogenesis, 9(8), 77-77 (2020-08-30)
Triple-negative breast cancer (TNBC) is a highly metastatic breast cancer subtype and due to the lack of hormone receptors and HER2 expression, TNBC has limited therapeutic options with chemotherapy being the primary choice for systemic therapy. LIM Domain Kinase 2
M V Gammons et al.
British journal of cancer, 111(3), 477-485 (2014-07-11)
Current therapies for metastatic melanoma are targeted either at cancer mutations driving growth (e.g., vemurafenib) or immune-based therapies (e.g., ipilimumab). Tumour progression also requires angiogenesis, which is regulated by VEGF-A, itself alternatively spliced to form two families of isoforms, pro-

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico