Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU060321

Sigma-Aldrich

MISSION® esiRNA

targeting human ALDH1A3, RP11-66B24.4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
En este momento no podemos mostrarle ni los precios ni la disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGGGTCTTTGTGGATTGCATGTTGACATTGACCGTGAGATTCGGCTTCAAACCAATACTGCCTTTGGAATATGACAGAATCAATAGCCCAGAGAGCTTAGTCAAAGACGATATCACGGTCTACCTTAACCAAGGCACTTTCTTAAGCAGAAAATATTGTTGAGGTTACCTTTGCTGCTAAAGATCCAATCTTCTAACGCCACAACAGCATAGCAAATCCTAGGATAATTCACCTCCTCATTTGACAAATCAGAGCTGTAATTCGCTTTAACAAATTACGCATTTCTATCACGTTCACTAACAGCTTATGATAAGTCTGTGTAGTCTTCCTTTTCTCCAGTTCTGTTACCCAATTTAGATTAGTAAAGCGTACACAACTGGAAAGACTGCTGTAATAACACAGCCTTGTTATTTTTAAGTCCTATTTTGATATTAATTTCTGATTAGTTAGTAAATAACACCTGGATTCTATGGAGGACCTCGGTC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Daisuke Yamashita et al.
Molecular cancer therapeutics, 19(5), 1134-1147 (2020-03-05)
The development of efficacious therapies targeting metastatic spread of breast cancer to the brain represents an unmet clinical need. Accordingly, an improved understanding of the molecular underpinnings of central nervous system spread and progression of breast cancer brain metastases (BCBM)
Vita Golubovskaya et al.
Journal of cancer research and clinical oncology, 141(9), 1613-1631 (2015-02-07)
Focal adhesion kinase is an important survival signal in cancer. Recently, we demonstrated that the autophosphorylation inhibitor of FAK, Y15, effectively inhibited cancer cell growth. We detected many cancer cell lines sensitive to Y15 and also detected several cell lines

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico