Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU059511

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGB4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTGGTCATGGAGAGCAGCTTCCAAATCACAGAGGAGACCCAGATTGACACCACCCTGCGGCGCAGCCAGATGTCCCCCCAAGGCCTGCGGGTCCGTCTGCGGCCCGGTGAGGAGCGGCATTTTGAGCTGGAGGTGTTTGAGCCACTGGAGAGCCCCGTGGACCTGTACATCCTCATGGACTTCTCCAACTCCATGTCCGATGATCTGGACAACCTCAAGAAGATGGGGCAGAACCTGGCTCGGGTCCTGAGCCAGCTCACCAGCGACTACACTATTGGATTTGGCAAGTTTGTGGACAAAGTCAGCGTCCCGCAGACGGACATGAGGCCTGAGAAGCTGAAGGAGCCCTGGCCCAACAGTGACCCCCCCTTCTCCTTCAAGAACGTCATCAGCCTGACAGAAGATGTGGATGAGTTCCGG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiangli Meng et al.
Bosnian journal of basic medical sciences, 20(1), 106-116 (2019-06-27)
Pancreatic cancer is the fourth leading cause of cancer death, with a 5-year survival rate of only 1-4%. Integrin-mediated cell adhesion is critical for the initiation, progression, and metastasis of cancer. In this study we investigated the role of integrin
Jin Sol Sung et al.
Oncogene, 39(3), 664-676 (2019-09-20)
Integrin beta 4 (ITGB4) overexpression in cancer cells contributes to cancer progression. However, the role of stromal ITGB4 expression in cancer progression remains poorly understood, despite stromal ITGB4 overexpression in malignant cancers. In our study, ITGB4-overexpressing triple negative breast cancer
Rachel Evans et al.
Cell reports, 27(7), 1967-1978 (2019-05-16)
Lymphatic vasculature is crucial for metastasis in triple-negative breast cancer (TNBC); however, cellular and molecular drivers controlling lymphovascular metastasis are poorly understood. We define a macrophage-dependent signaling cascade that facilitates metastasis through lymphovascular remodeling. TNBC cells instigate mRNA changes in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico