Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU055871

Sigma-Aldrich

MISSION® esiRNA

targeting human ETV5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Check Cart for Availability


Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Check Cart for Availability

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TACCATCGGCAAATGTCAGAACCTATTGTCCCTGCAGCTCCCCCGCCCCCTCAGGGATTCAAACAAGAATACCATGACCCACTCTATGAACATGGGGTCCCGGGCATGCCAGGGCCCCCAGCACACGGGTTCCAGTCACCAATGGGAATCAAGCAGGAGCCTCGGGATTACTGCGTCGATTCAGAAGTGCCTAACTGCCAGTCATCCTACATGAGAGGGGGTTATTTCTCCAGCAGCCATGAAGGTTTTTCATATGAAAAAGATCCCCGATTATACTTTGACGACACTTGTGTTGTGCCTGAGAGACTGGAAGGCAAAGTCAAACAGGAGCCTACCATGTATCGAGAGGGGCCCCCTTACCAGAGGCGAGGTTCCCTTCAGCTGTGGCAGTTCCTGGTCACCCTTCTTGATGACCCAGCCAATGCCCACTTCATTGCCTGGACAGGT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jong-Min Park et al.
Free radical biology & medicine, 110, 151-161 (2017-06-13)
8-hydroxydeoxyguanosine (8-OHdG) is generated consequent to oxidative stress, but its paradoxical anti-oxidative, anti-inflammatory, and anti-mutagenic effects via Rho-GTPase inhibition were noted in various models of inflammation and cancer. Metastasis occurs through cell detachment, epithelial-mesenchymal transition (EMT), and cell migration; during
Duy Pham et al.
The Journal of allergy and clinical immunology, 134(1), 204-214 (2014-02-04)
The differentiation of TH17 cells, which promote pulmonary inflammation, requires the cooperation of a network of transcription factors. We sought to define the role of Etv5, an Ets-family transcription factor, in TH17 cell development and function. TH17 development was examined
Félicie Cottard et al.
Oncotarget, 8(42), 72008-72020 (2017-10-27)
Constitutively active androgen receptor (AR) variants have been involved in the expression of mesenchymal markers such as N-cadherin in prostate cancer (PCa). However, the underlying molecular mechanisms remain elusive. It remains unclear, whether N-cadherin gene (CDH2) is a direct transcriptional
Oorvashi Roy Puli et al.
Neoplasia (New York, N.Y.), 20(11), 1121-1134 (2018-09-29)
The ETS family of transcription factors is involved in several normal remodeling events and pathological processes including tumor progression. ETS transcription factors are divided into subfamilies based on the sequence and location of the ETS domain. ETV5 (Ets variant gene
Yong Cheng et al.
PLoS pathogens, 16(5), e1008569-e1008569 (2020-05-29)
Mycobacterial infection leads to activation of the RIG-I/MAVS/TBK1 RNA sensing pathway in macrophages but the consequences of this activation remains poorly defined. In this study, we determined that activation of this RNA sensing pathway stimulates ICAM-1 expression in M.avium-infected macrophage

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico