Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU052821

Sigma-Aldrich

MISSION® esiRNA

targeting human NISCH

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTTTTGGGACCAGCAACATTCAGGAGCAGCTCCTGCCGTTCGACCTATCAATATTCAAGTCCCTGCATCAGGTGGAGATAAGTCACTGTGATGCTAAGCACATCAGAGGGCTGGTCGCATCGAAGCCCACCTTAGCCACGCTGAGTGTCCGCTTCTCAGCAACCTCGATGAAGGAAGTCCTTGTTCCTGAAGCCTCAGAATTTGATGAGTGGGAGCCTGAAGGCACAACCCTAGAAGGCCCTGTGACTGCCGTCATCCCCACTTGGCAGGCATTGACCACGCTTGACCTGAGCCACAACAGCGTCTCCGAGATCGACGAGTCTGTGAAACTGATCCCAAAGATTGAGTTCCTGGACCTGAGTCACAATGGATTGCTGGTTGTGGACAATCTGCAGCACCTGTATAACCTTGTGCATCTGGACCTGTCCTACAACAAGCTCTCCTCCTTGG

Ensembl | nº de acceso humano

ENSG00000010322

Nº de acceso NCBI

NM_007184

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NISCH(11188) , NISCH(11188)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yue-Min Ding et al.
Neural regeneration research, 12(10), 1687-1694 (2017-11-25)
A previous study by our group found that inhibition of nischarin promotes neurite outgrowth and neuronal regeneration in Neuro-2a cells and primary cortical neurons. In recent years, more and more studies have shown that nanomaterials have good prospects in treatment
Moran Dvela-Levitt et al.
Cell, 178(3), 521-535 (2019-07-28)
Intracellular accumulation of misfolded proteins causes toxic proteinopathies, diseases without targeted therapies. Mucin 1 kidney disease (MKD) results from a frameshift mutation in the MUC1 gene (MUC1-fs). Here, we show that MKD is a toxic proteinopathy. Intracellular MUC1-fs accumulation activated

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico