Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU052411

Sigma-Aldrich

MISSION® esiRNA

targeting human HHEX

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00

Fecha estimada de envío13 de mayo de 2025

Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00

Fecha estimada de envío13 de mayo de 2025

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GATTCTCCAACGACCAGACCATCGAGCTGGAGAAGAAATTCGAGACGCAGAAATATCTCTCTCCGCCCGAGAGGAAGCGTCTGGCCAAGATGCTGCAGCTCAGCGAGAGACAGGTCAAAACCTGGTTTCAGAATCGACGCGCTAAATGGAGGAGACTAAAACAGGAGAACCCTCAAAGCAATAAAAAAGAAGAACTGGAAAGTTTGGACAGTTCCTGTGATCAGAGGCAAGATTTGCCCAGTGAACAGAATAAAGGTGCTTCTTTGGATAGCTCTCAATGTTCGCCCTCCCCTGCCTCCCAGGAAGACCTTGAATCAGAGATTTCAGAGGATTCTGATCAGGAAGTGGACATTGAGGGCGATAAAAGCTATTTTAATGCTGGATGATGACCACTGGCATTG

Ensembl | nº de acceso humano

ENSG00000152804

Nº de acceso NCBI

NM_002729

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... HHEX(3087) , HHEX(3087)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

R M Kershaw et al.
Oncogenesis, 6(6), e346-e346 (2017-06-13)
Breast tumours progress from hyperplasia to ductal carcinoma in situ (DCIS) and invasive breast carcinoma (IBC). PRH/HHEX (proline-rich homeodomain/haematopoietically expressed homeobox) is a transcription factor that displays both tumour suppressor and oncogenic activity in different disease contexts; however, the role
Eudmar Marcolino et al.
Oncogenesis, 9(2), 10-10 (2020-02-06)
Cancer cells go through a process known as epithelial-mesenchymal transition (EMT) during which they acquire the ability to migrate and invade extracellular matrix. Some cells also acquire the ability to move across a layer of endothelial cells to enter and
Philip Kitchen et al.
Cancer research, 80(4), 757-770 (2019-12-18)
Aberrant Notch and Wnt signaling are known drivers of cholangiocarcinoma (CCA), but the underlying factors that initiate and maintain these pathways are not known. Here, we show that the proline-rich homeodomain protein/hematopoietically expressed homeobox (PRH/HHEX) transcription factor forms a positive

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico