Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU050541

Sigma-Aldrich

MISSION® esiRNA

targeting human FSCN1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCTGTCTGCCAATCAGGACGAGGAGACCGACCAGGAGACCTTCCAGCTGGAGATCGACCGCGACACCAAAAAGTGTGCCTTCCGTACCCACACGGGCAAGTACTGGACGCTGACGGCCACCGGGGGCGTGCAGTCCACCGCCTCCAGCAAGAATGCCAGCTGCTACTTTGACATCGAGTGGCGTGACCGGCGCATCACACTGAGGGCGTCCAATGGCAAGTTTGTGACCTCCAAGAAGAATGGGCAGCTGGCCGCCTCGGTGGAGACAGCAGGGGACTCAGAGCTCTTCCTCATGAAGCTCATCAACCGCCCCATCATCGTGTTCCGCGGGGAGCATGGCTTCATCGGCTGCCGCAAGGTCACGGGCACCCTGGACGCCAACCGCTCCAGCTATGACGTCTTCCAGCTGGAGTTCAACGATGGCGCCTACAACATCAAAGACTCCACAGGCA

Ensembl | human accession no.

ENSG00000075618

NCBI accession no.

NM_003088

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FSCN1(6624) , FSCN1(6624)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wei Gao et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 27(2), 365-379 (2018-10-21)
Laryngeal squamous cell carcinoma (LSCC) is a common form of head and neck cancer with poor prognosis. However, the mechanism underlying the pathogenesis of LSCC remains unclear. Here, we demonstrated increased expression of fascin actin-bundling protein 1 (FSCN1) and decreased
Priscila Campioni Rodrigues et al.
Oncotarget, 8(43), 74736-74754 (2017-11-02)
Oral squamous cell carcinoma (OSCC) prognosis is related to clinical stage and histological grade. However, this stratification needs to be refined. We conducted a comparative proteome study in microdissected samples from normal oral mucosa and OSCC to identify biomarkers for
Sean McGuire et al.
Gynecologic oncology, 153(2), 405-415 (2019-02-25)
Ovarian cancer (OvCa) metastasis requires the coordinated motility of both cancer and stromal cells. Cellular movement is a dynamic process that involves the synchronized assembly of f-actin bundles into cytoskeletal protrusions by fascin. Fascin directly binds f-actin and is an
Aihua Luo et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 73, 75-79 (2015-07-28)
Fascin actin-bundling protein 1 (FSCN1) plays significant roles in biological processes such as tumor cell invasion and metastasis. However, little is known about prognostic value of FSCN1 in non-small cell lung cancer (NSCLC). FSCN1 mRNA and protein expression were detected
Sunil Acharya et al.
Cancer research, 79(16), 4211-4226 (2019-06-27)
Triple-negative breast cancer (TNBC) is the most aggressive breast cancer subtype. To identify TNBC therapeutic targets, we performed integrative bioinformatics analysis of multiple breast cancer patient-derived gene expression datasets and focused on kinases with FDA-approved or in-pipeline inhibitors. Sphingosine kinase
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico