Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU049781

Sigma-Aldrich

MISSION® esiRNA

targeting human NOX5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Fecha estimada de envío11 de mayo de 2025



Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Fecha estimada de envío11 de mayo de 2025


descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTGTCGAGGAGTGTGACAATGAGAAAGAGTCAAAGGTCGTCCAAGGGCTCTGAGATACTTTTGGAGAAACACAAATTCTGTAACATCAAGTGCTACATCGATGGGCCTTATGGGACCCCCACCCGCAGGATCTTTGCCTCTGAGCATGCCGTGCTCATCGGGGCAGGCATCGGCATCACCCCCTTTGCTTCCATTCTGCAGAGTATCATGTACAGGCACCAGAAAAGAAAGCATACTTGCCCCAGCTGCCAGCACTCCTGGATCGAAGGTGTCCAAGACAACATGAAGCTCCATAAGGTGGACTTTATCTGGATCAACAGAGACCAGCGGTCTTTCGAGTGGTTTGTGAGCCTGCTGACTAAACTGGAGATGGACCAGGCCGAGGAGGCTCAATACGGCCGCTTCCTGGAGCTGCATATGTACATGACATCTGCACTGGGCAAGAATGACATG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Farhan Rizvi et al.
PloS one, 7(4), e34440-e34440 (2012-04-19)
To determine whether NOX 5 is expressed in rabbit corneal stromal cells (RCSC). NADPH oxidases (NOXes) are enzymes that preferentially use NADPH as a substrate and generate superoxide. Several isoforms of NOXes function as multi-protein complexes while NOX5 and DUOXs
Dan Li et al.
The Journal of pharmacology and experimental therapeutics, 360(1), 14-22 (2016-10-21)
We have shown that NADPH oxidase (NOX)5-S may mediate the acid-induced decrease in cell apoptosis. However, mechanisms of NOX5-S-dependent decrease in cell apoptosis are not fully understood. In this study, we found that silencer-of-death domain (SODD) was significantly increased in
Jie Chen et al.
Signal transduction and targeted therapy, 5(1), 139-139 (2020-08-15)
Reactive oxygen species (ROS) localized at the precise subcellular compartments are essential for regulating the activity of signaling proteins. Furthermore, ROS are master regulators of tumor malignant progression that respond to a diverse set of environmental stress, especially hypoxia. NADPH
Hope K A Gole et al.
PloS one, 9(8), e105337-e105337 (2014-08-22)
NADPH oxidase (NOX) is the primary source of reactive oxygen species (ROS) in vascular smooth muscle cells (SMC) and is proposed to play a key role in redox signaling involved in the pathogenesis of cardiovascular disease. Growth factors and cytokines
S Carnesecchi et al.
Free radical biology & medicine, 84, 22-29 (2015-03-24)
Reactive oxygen species (ROS) are key modulators of apoptosis and carcinogenesis. One of the important sources of ROS is NADPH oxidases (NOXs). The isoform NOX5 is highly expressed in lymphoid tissues, but it has not been detected in any common

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico