Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU049731

Sigma-Aldrich

MISSION® esiRNA

targeting human PDS5B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAAGCAACCTGGAACATCTCATAACACCATTGGTTACTATTGGTCATATTGCTCTCCTTGCACCTGATCAATTTGCTGCTCCTTTGAAATCTTTGGTAGCTACTTTCATTGTGAAAGATCTTCTCATGAATGATCGGCTTCCAGGGAAAAAGACAACTAAACTTTGGGTTCCAGATGAAGAAGTATCTCCTGAGACAATGGTCAAAATTCAGGCTATTAAAATGATGGTTCGATGGCTACTTGGAATGAAAAATAATCACAGTAAATCAGGAACTTCTACCTTAAGATTGCTAACAACAATATTGCATAGTGATGGAGACTTGACAGAACAGGGGAAAATTAGTAAACCAGATATGTCACGTCTGAGACTTGCTGCTGGGAGTGCTATTGTGAAGCTGGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sujuan Xu et al.
Life sciences, 264, 118636-118636 (2020-11-06)
LncRNA HOXB-AS3 is proved as an oncogene in tumors. Herein, we determine the function and mechanism of HOXB-AS3 in epithelial ovarian cancer (EOC) cells. Chi-square test, Kaplan-Meier (KM) analysis and Cox regression analysis were used to analyze the clinicopathological features
Qifang Liu et al.
Infectious agents and cancer, 14, 37-37 (2019-12-14)
It has been reported that lncRNA MAGI2-AS3 can promote many types of cancer, such as breast cancer and bladder cancer, by regulating cell behaviors, such a proliferation, invasion, and migration. However, its role in cervical squamous cell carcinoma (CSCC) is
Gordana Wutz et al.
The EMBO journal, 36(24), 3573-3599 (2017-12-09)
Mammalian genomes are spatially organized into compartments, topologically associating domains (TADs), and loops to facilitate gene regulation and other chromosomal functions. How compartments, TADs, and loops are generated is unknown. It has been proposed that cohesin forms TADs and loops

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico