Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU049601

Sigma-Aldrich

MISSION® esiRNA

targeting human FA2H

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCTTCATGCTGGGGACATTCCTCTGGAGCCTCATCGAGTACCTCATCCACCGCTTCCTGTTCCACATGAAGCCCCCCAGCGACAGCTATTACCTCATCATGCTGCACTTCGTCATGCACGGCCAGCACCACAAGGCACCCTTCGACGGCTCCCGCCTGGTCTTCCCCCCTGTGCCAGCCTCCCTGGTGATCGGCGTCTTCTACTTGTGCATGCAGCTCATCCTGCCCGAGGCAGTAGGGGGCACTGTGTTTGCGGGGGGCCTCCTGGGCTACGTCCTCTATGACATGACCCATTACTACCTGCACTTTGGCTCGCCGCACAAGGGCTCCTACCTGTACAGCCTGAAGGCCCACCACGTCAAGCACCACTTTGCACATCAGAAGTCAGGATTTGGTATCAGCACTAAATTGTGGGATTACTGTTTCCACACCCTCACTCCAGAGAAACCCCACCT

Ensembl | human accession no.

ENSG00000103089

NCBI accession no.

NM_024306

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FA2H(79152) , FA2H(79152)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Masayo Hirao-Suzuki et al.
Biochemical and biophysical research communications, 531(2), 215-222 (2020-08-17)
The functional role of fatty acid 2-hydroxylase (FA2H) is controversial in the field of cancer biology due to the dual role of FA2H, particularly related to its interaction with triple-negative breast cancer (TNBC). A previous biochemical- and clinical-focused study suggested
Bo Hong et al.
Open medicine (Warsaw, Poland), 15(1), 882-889 (2020-12-22)
MicroRNA (miR/miRNA) expression disorders play a crucial role in the development of gastric cancer (GC). Increasing evidence has indicated that miRNAs participate in the process of numerous cancers. Previous research has demonstrated that miR-300 acts as a cancer-promoting factor or
Bishuang Gong et al.
Molecular immunology, 122, 173-185 (2020-05-07)
Thymic epithelial cells (TECs) are essential regulators of T cell development and selection. microRNAs (miRNAs) play critical roles in regulating TECs proliferation during thymus involution. miR-205-5p is highly expressed in TECs and increases with age. However, the function and potential
Janani Ravi et al.
Oncotarget, 5(9), 2475-2486 (2014-05-09)
The endocannabinoid anandamide (AEA), a neurotransmitter was shown to have anti-cancer effects. Fatty acid amide hydrolase (FAAH) metabolizes AEA and decreases its anti-tumorigenic activity. In this study, we have analyzed the role of FAAH inhibition in non-small cell lung cancer

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico