Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU049311

Sigma-Aldrich

MISSION® esiRNA

targeting human UNC5D

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
En este momento no podemos mostrarle ni los precios ni la disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAGAGCTCGTTCATGGTTTCCCTGGGAGTGTCTGAGAGAGCTGAGTACCACGGCAAGAATCATTCCAGGACTTTTCCCCATGGAAACAACCACAGCTTTAGTACAATGCATCCCAGAAATAAAATGCCCTACATCCAAAATCTGTCATCACTCCCCACAAGGACAGAACTGAGGACAACTGGTGTCTTTGGCCATTTAGGGGGGCGCTTAGTAATGCCAAATACAGGGGTGAGCTTACTCATACCACACGGTGCCATCCCAGAGGAGAATTCTTGGGAGATTTATATGTCCATCAACCAAGGTGAACCCAGCCTCCAGTCAGATGGCTCTGAGGTGCTCCTGAGTCCTGAAGTCACCTGTGGTCCTCCAGACATGATCGTCACCACTCCCTTTGCATTGAC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yuyan Zhu et al.
The Journal of urology, 192(2), 575-582 (2014-02-13)
Identifying potential targets would improve therapeutic planning and disease management. Therefore, we investigated whether the novel identified dependence receptor UNC5D acts as a tumor suppressor in bladder malignancies. We assessed the UNC5D level in a panel of 15 primary bladder carcinomas
Priya Srikanth et al.
Translational psychiatry, 8(1), 245-245 (2018-11-10)
The identification of convergent phenotypes in different models of psychiatric illness highlights robust phenotypes that are more likely to be implicated in disease pathophysiology. Here, we utilize human iPSCs harboring distinct mutations in DISC1 that have been found in families

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico