Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU047861

Sigma-Aldrich

MISSION® esiRNA

targeting human HOXA13

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGTTGCTTTGCCCAGATAATGATAATAATGCTTAATAATAATTGAAGAATGGGAAAGAGAAAGAGACAGAGACTGGCATTTTCCTCTCCCGAAGGAGATCTCTTTCTCTTTAATGGAATCTACAACTGTTTTAAAACTTTAAGAAAGGTAAAGACTGCCAGTTCTTCCGCCAACCCCATCAGCCCAGCCCGTTAAATGTCAAACGTCAACCCCCAAAATACGCAATTTCAGATAAGTTACGCAGTTACTGAAATCTTGTAAGTATTTAAGTGATCGTTACATTTTAGGACACTGCGTTAGATGGTAATAATCTGGAAGTTGGTTACAAACGCAAGAGGCCATTGTAAACATCTGCTTGTCCTTCTTAGGTCGCCATTCCCTTTGCATGTTAAGCGTCTGCTCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Y-X He et al.
European review for medical and pharmacological sciences, 21(2), 258-265 (2017-02-07)
In this study, we investigated the association between HOXA13 dysregulation and gastric cancer progression. We also explored the functional role of HOXA13 in invasion and epithelial-to-mesenchymal transition (EMT) of gastric cancer cells and the possible signaling pathway it might involve
Hua Xie et al.
Biochemical and biophysical research communications, 463(4), 569-574 (2015-06-06)
Long noncoding RNAs (lncRNAs) have been confirmed to be associated with various human diseases. However, whether they are associated with Hirschsprung disease (HSCR) progression remains unclear. In this study, we designed the experiment to explore the relationship between lncRNA HOTTIP

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico