Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU044111

Sigma-Aldrich

MISSION® esiRNA

targeting human MFN2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGATCAGGCGCCTCTCTGTACTGGTGGACGATTACCAGATGGACTTCCACCCTTCTCCAGTAGTCCTCAAGGTTTATAAGAATGAGCTGCACCGCCACATAGAGGAAGGACTGGGTCGAAACATGTCTGACCGCTGCTCCACGGCCATCACCAACTCCCTGCAGACCATGCAGCAGGACATGATAGATGGCTTGAAACCCCTCCTTCCTGTGTCTGTGCGGAGTCAGATAGACATGCTGGTCCCACGCCAGTGCTTCTCCCTCAACTATGACCTAAACTGTGACAAGCTGTGTGCTGACTTCCAGGAAGACATTGAGTTCCATTTCTCTCTCGGATGGACCATGCTGGTGAATAGGTTCCTGGGCCCCAAGAACAGCCGTCGGGCCTTGATGGGCTACAATGACCA

Ensembl | human accession no.

ENSG00000116688

NCBI accession no.

NM_014874

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MFN2(9927) , MFN2(9927)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yong Sun Lee et al.
Cancer letters, 433, 156-164 (2018-07-10)
Parkin, a critical gene of Parkinson's disease, is involved in the development of numerous cancers. However, the effect of parkin deficiency on melanoma growth and metastasis has not been reported. We showed that the tumor size and number of surface
Hongcai Cai et al.
Placenta, 70, 34-40 (2018-10-15)
Miscarriage is a common complication during pregnancy. Mitofusin-2 (MFN2) deficiency in trophoblastic cells is reported to be an important cause for early miscarriage. MFN2 can regulate mitochondrial autophagy, although the mechanisms remain unknown. This study aims to investigate the roles
Jihong Dong et al.
Journal of dairy science, 103(6), 5561-5574 (2020-04-13)
Inflammation is critical in the progression from benign hepatic lipidosis to pathological hepatic steatosis. The objective of this study was to examine the potential role of the outer mitochondrial membrane protein mitofusin 2 (MFN2) in the etiology of hepatic steatosis
Rui Zhang et al.
Molecular and cellular endocrinology, 452, 33-43 (2017-05-11)
This study was performed to investigate the oxidative stress-induced miRNA changes in relation to pathogenesis of diabetic retinopathy (DR) and to establish a functional link between miRNAs and oxidative stress-induced retinal endothelial cell injury. Our results demonstrated that oxidative stress
S Givvimani et al.
International journal of cardiology, 187, 325-333 (2015-04-05)
Mitochondria constitute 30% of cell volume and are engaged in two dynamic processes called fission and fusion, regulated by Drp-1 (dynamin related protein) and mitofusin 2 (Mfn2). Previously, we showed that Drp-1 inhibition attenuates cardiovascular dysfunction following pressure overload in
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico