Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU043741

Sigma-Aldrich

MISSION® esiRNA

targeting human AEBP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGACACCAGGAGGACTACCCGGTTCACAGGCGTCATCACCCAGGGCAGAGACTCCAGCATCCATGACGATTTTGTGACCACCTTCTTCGTGGGCTTCAGCAATGACAGCCAGACATGGGTGATGTACACCAACGGCTATGAGGAAATGACCTTTCATGGGAACGTGGACAAGGACACACCCGTGCTGAGTGAGCTCCCAGAGCCGGTGGTGGCTCGTTTCATCCGCATCTACCCACTCACCTGGAATGGCAGCCTGTGCATGCGCCTGGAGGTGCTGGGGTGCTCTGTGGCCCCTGTCTACAGCTACTACGCACAGAATGAGGTGGTGGCCACCGATGACCTGGATTTCCGGCACCACAGCTACAAGGACATGCGCCAGCTCATGAAGGTGGTGAACGAGGAGTG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kai Guo et al.
Behavioural neurology, 2020, 8890452-8890452 (2020-11-24)
Our study was aimed at investigating the mechanistic consequences of the upregulation of adipocyte enhancer-binding protein 1 (AEBP1) in glioblastoma (GBM). The expression of AEBP1 in GBM was assessed by bioinformatics analysis and qRT-PCR; the effects of AEBP1 on GBM
Shouchao Li et al.
Oncology letters, 17(1), 55-62 (2019-01-19)
The present study aimed to analyze adipocyte enhancer-binding protein 1 (AEBP1) expression in colorectal cancer (CRC), with a focus on its possible molecular mechanisms, in order to provide novel insight into the clinical treatment of CRC. Immunohistochemistry (IHC) was used

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico