Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU043701

Sigma-Aldrich

MISSION® esiRNA

targeting human BATF

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00

Fecha estimada de envío28 de abril de 2025

Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00

Fecha estimada de envío28 de abril de 2025

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGCAAACAGGACTCATCTGATGATGTGAGAAGAGTTCAGAGGAGGGAGAAAAATCGTATTGCCGCCCAGAAGAGCCGACAGAGGCAGACACAGAAGGCCGACACCCTGCACCTGGAGAGCGAAGACCTGGAGAAACAGAACGCGGCTCTACGCAAGGAGATCAAGCAGCTCACAGAGGAACTGAAGTACTTCACGTCGGTGCTGAACAGCCACGAGCCCCTGTGCTCGGTGCTGGCCGCCAGCACGCCCTCGCCCCCCGAGGTGGTGTACAGCGCCCACGCATTCCACCAACCTCATGTCAGCTCCCCGCGCTTCCAGCCCTGAGCTTCCGATGCGGGGAGAGCAGAGCCTCGGGAGGGGCACACAGACTGTGGCAGAGCTGCGCCCATCCCGCAGAGGCCCCTGTCCACCTGGAGACCCGGAGACAGAGGCCTGGACAAGGAGTGAACACGGGAACTGT

Ensembl | nº de acceso humano

ENSG00000156127

Nº de acceso NCBI

NM_006399

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BATF(10538) , BATF(10538)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jia-Yu Zhong et al.
Annals of the New York Academy of Sciences, 1474(1), 61-72 (2020-06-03)
Long noncoding RNAs (lncRNAs) have been investigated as novel regulatory molecules involved in diverse biological processes. Our previous study demonstrated that lncRNA-ES3 is associated with the high glucose-induced calcification/senescence of human aortic vascular smooth muscle cells (HA-VSMCs). However, the mechanism
Sahil Gupta et al.
Oncoimmunology, 7(10), e1494110-e1494110 (2018-10-06)
Macrophages in the tumor microenvironment respond to complex cytokine signals. How these responses shape the phenotype of tumor-associated macrophages (TAMs) is incompletely understood. Here we explored how cytokines of the tumor milieu, interleukin (IL)-6 and IL-4, interact to influence target

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico