Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU043671

Sigma-Aldrich

MISSION® esiRNA

targeting human SENP3, SENP3-EIF4A1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTCCCTGAAAAGGTGCATTTCTTCAATAGTTTCTTCTATGATAAACTCCGTACCGGTTATGATGGGGTGAAAAGGTGGACCAAAAACGTGGACATCTTCAATAAGGAGCTACTGCTAATCCCCATCCACCTGGAGGTGCATTGGTCCCTCATCTCTGTTGATGTGAGGCGACGCACCATCACCTATTTTGACTCGCAGCGTACCCTAAACCGCCGCTGCCCTAAGCATATTGCCAAGTATCTACAGGCAGAGGCGGTAAAGAAAGACCGACTGGATTTCCACCAGGGCTGGAAAGGTTACTTCAAAATGAATGTGGCCAGGCAGAATAATGACAGTGACTGTGGTGCTTTTGTGTTGCAGTACTGCAAGCATCTGGCCCTGTCTCAGCCATTCAGCTTCACCCAGCAGGACATGCCCAAACTTCGTCGGCAGATCTACAAGGAGCTGTGTCACTGCAAA

Ensembl | human accession no.

ENSG00000161956

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SENP3(26168) , SENP3(26168)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Y Zhang et al.
European review for medical and pharmacological sciences, 22(9), 2778-2786 (2018-05-18)
To investigate whether SENP3 protects H9C2 cells from apoptosis triggered by H/R through the signal transducer and activator of transcription 3 (STAT3) pathway. Male C57BL mice were cultured and mouse models of myocardial I/RI were established. At the same time
Jia Luo et al.
The Journal of toxicological sciences, 42(5), 529-538 (2017-07-28)
Increased post-translational modification of proteins by SUMO-2/3 is a cytoprotective response against cell stress induced by ischaemia and reperfusion. However, it is still unclear what other cell stressors trigger protein SUMOylation, what mechanisms enhance and maintain the enhanced SUMOylation, and
Chun Guo et al.
Scientific reports, 7, 43811-43811 (2017-03-07)
The GTPase dynamin-related protein 1 (Drp1) is essential for physiological and pathophysiological mitochondrial fission. DeSUMOylation of Drp1 by the enzyme SENP3 promotes cell death during reperfusion after ischaemia by enhancing Drp1 partitioning to the mitochondrial outer membrane (MOM), which causes
Chun-Jie Huang et al.
Biochimica et biophysica acta, 1864(7), 1195-1206 (2017-03-21)
Understanding the mechanisms underlying abnormal egg production and pregnancy loss is significant for human fertility. SENP7, a SUMO poly-chain editing enzyme, has been regarded as a mitotic regulator of heterochromatin integrity and DNA repair. Herein, we report the roles of
Arnab Nayak et al.
Cell reports, 27(9), 2725-2736 (2019-05-30)
Precise assembly of the sarcomere, a force-generating unit in striated muscles, is critical for muscle contraction. Defective sarcomere organization is linked to myopathies and cachexia. The molecular mechanisms concerning sarcomere assembly are poorly understood. Here, we report that the SUMO-specific
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico