Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU043401

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
En este momento no podemos mostrarle ni los precios ni la disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGTGGATGTGGATGTGTCCTCTGGCTTTATTTATTGGTGTGATTTTAGCAGCTCAGTGGCATCTGATAATGCGATCCGTAGAATTAAACCAGATGGATCTTCTCTGATGAACATTGTGACACATGGAATAGGAGAAAATGGAGTCCGGGGTATTGCAGTGGATTGGGTAGCAGGAAATCTTTATTTCACCAATGCCTTTGTTTCTGAAACACTGATAGAAGTTCTGCGGATCAATACTACTTACCGCCGTGTTCTTCTTAAAGTCACAGTGGACATGCCTAGGCATATTGTTGTAGATCCCAAGAACAGATACCTCTTCTGGGCTGACTATGGGCAGAGACCAAAGATTGAGCGTTCTTTCCTTGACTGTACCAATCGAACAGTGCTTGTGTCAGAGGGCATTGTC

Ensembl | nº de acceso humano

ENSG00000081479

Nº de acceso NCBI

NM_004525

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... LRP2(4036) , LRP2(4036)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ITU
OLU
BCS
AXR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yuan Gao et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(6), 7684-7693 (2019-03-21)
Osteoblast differentiation of human mesenchymal stem cells (hMSCs) is stimulated by 1α,25-dihydroxycholecalciferol [1α,25(OH)2D3] and 25-hydroxycholecalciferol [25(OH)D3]; the latter's effects require intracellular hydroxylation to 1α,25(OH)2D3. Thus, hMSCs are both a source of and target for 1α,25(OH)2D3. Megalin is a transmembrane receptor
Kimberly R Long et al.
American journal of physiology. Renal physiology, 318(3), F851-F859 (2020-02-19)
Albuminuria is frequently associated with proximal tubule (PT) cytotoxicity that can feed back to cause glomerular damage and exacerbate kidney disease. PT cells express megalin and cubilin receptors that bind to and internalize albumin over a broad concentration range. How
Aurélien Briens et al.
Cell discovery, 3, 17001-17001 (2017-04-19)
Plasminogen activation is involved in many processes within the central nervous system, including synaptic plasticity, neuroinflammation and neurodegeneration. However, the mechanisms that regulate plasminogen activation in the brain still remain unknown. Here we demonstrate that astrocytes participate in this regulation
Jeanne L Theis et al.
eLife, 9 (2020-10-03)
Congenital heart diseases (CHDs), including hypoplastic left heart syndrome (HLHS), are genetically complex and poorly understood. Here, a multidisciplinary platform was established to functionally evaluate novel CHD gene candidates, based on whole-genome and iPSC RNA sequencing of a HLHS family-trio.
Rohit Upadhyay et al.
JCI insight, 5(14) (2020-06-17)
Free light chains (FLCs) induce inflammatory pathways in proximal tubule cells (PTCs). The role of TLRs in these responses is unknown. Here we present findings on the role of TLRs in FLC-induced PTC injury. We exposed human kidney PTC cultures

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico