Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU042211

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCR6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGGTTCAGCAGTTTCAATGACAGCAGCCAGGAGGAGCATCAAGACTTCCTGCAGTTCAGCAAGGTCTTTCTGCCCTGCATGTACCTGGTGGTGTTTGTCTGTGGTCTGGTGGGGAACTCTCTGGTGCTGGTCATATCCATCTTCTACCATAAGTTGCAGAGCCTGACGGATGTGTTCCTGGTGAACCTACCCCTGGCTGACCTGGTGTTTGTCTGCACTCTGCCCTTCTGGGCCTATGCAGGCATCCATGAATGGGTGTTTGGCCAGGTCATGTGCAAGAGCCTACTGGGCATCTACACTATTAACTTCTACACGTCCATGCTCATCCTCACCTGCATCACTGTGGATCGTTTCATTGTAGTGGTTAAGGCCACCAAGGCCTACAACCAGCAAGCCAAGAGGATGACCTGGGGCAAGGTCACCAGCTTGCTCATCTGGGTGATATCCCTGCTGGTTTCCTTG

Ensembl | nº de acceso humano

ENSG00000172215

Nº de acceso NCBI

NM_006564

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CXCR6(10663) , CXCR6(10663)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Seung-Cheol Lee et al.
Stem cells international, 2020, 8870133-8870133 (2020-09-15)
Human mesenchymal stem cells derived from adipose tissue (hADMSCs) are a desirable candidate in regenerative medicine. hADMSCs secrete growth factors, cytokines, and chemokines and also express various receptors that are important in cell activation, differentiation, and migration to injured tissue.
Zhenzhen Ma et al.
International immunopharmacology, 81, 106035-106035 (2019-11-23)
Interstitial lung disease (ILD) is a progressive and irreversible lung disease with very limited therapeutic options. Previous studies have found that chemokine ligands CXCL16 and CXCR6 play critical roles in organ fibrosis. However, whether CXCL16 and CXCR6 are also involved

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico