Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU039071

Sigma-Aldrich

MISSION® esiRNA

targeting human AHR, RP11-507K12.1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTTCCAAGCGGCATAGAGACCGACTTAATACAGAGTTGGACCGTTTGGCTAGCCTGCTGCCTTTCCCACAAGATGTTATTAATAAGTTGGACAAACTTTCAGTTCTTAGGCTCAGCGTCAGTTACCTGAGAGCCAAGAGCTTCTTTGATGTTGCATTAAAATCCTCCCCTACTGAAAGAAACGGAGGCCAGGATAACTGTAGAGCAGCAAATTTCAGAGAAGGCCTGAACTTACAAGAAGGAGAATTCTTATTACAGGCTCTGAATGGCTTTGTATTAGTTGTCACTACAGATGCTTTGGTCTTTTATGCTTCTTCTACTATACAAGATTATCTAGGGTTTCAGCAGTCTGATGTCATACATCAGAGTGTATATGAACTTATCCATACCGAAGACCGAGCTGAATTTC

Ensembl | nº de acceso humano

ENSG00000106546

Nº de acceso NCBI

NM_001621

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... AHR(196) , AHR(196)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
SPU
UOU
FRS
FQR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sean A Piwarski et al.
Biochemical pharmacology, 174, 113845-113845 (2020-02-08)
The aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor. Triple negative breast cancer (TNBC) is the most aggressive breast cancer subtype. TNBC expresses AHR and AHR ligands have anti-cancer activity in TNBC. The aggressiveness of TNBC is due in
Guillaume Lano et al.
International journal of molecular sciences, 21(7) (2020-04-05)
Endogenous agonists of the transcription factor aryl hydrocarbon receptor (AHR) such as the indolic uremic toxin, indoxyl sulfate (IS), accumulate in patients with chronic kidney disease. AHR activation by indolic toxins has prothrombotic effects on the endothelium, especially via tissue
Yaxin Zhang et al.
Biomolecules & therapeutics, 25(2), 202-212 (2016-11-11)
Doxorubicin (DOX) is a highly effective chemotherapeutic agent; however, the dose-dependent cardiotoxicity associated with DOX significantly limits its clinical application. In the present study, we investigated whether Rb1 could prevent DOX-induced apoptosis in H9C2 cells
Afshin Mohammadi-Bardbori et al.
Chemical research in toxicology, 32(4), 691-697 (2019-02-23)
The mechanisms underlying aryl hydrocarbon receptor (AHR) activation by agonists and circumstances that increase the sensitivity toward agonists and AHR inhibition by antagonists are diverse and still not fully understood. AHR antagonist, 2-methyl-2 H-pyrazole-3-carboxylic acid (2-methyl-4- o-tolylazo-phenyl)-amide, CH223191, has been
Laura Lozza et al.
Scientific reports, 9(1), 10878-10878 (2019-07-28)
As a first host barrier, the skin is constantly exposed to environmental insults that perturb its integrity. Tight regulation of skin homeostasis is largely controlled by the aryl hydrocarbon receptor (AhR). Here, we demonstrate that Henna and its major pigment
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico