Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU038621

Sigma-Aldrich

MISSION® esiRNA

targeting human B2M

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTCATCCATCCGACATTGAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTTGTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTACACTGAATTCACCCCCACTGAAAAAGATGAGTATGCCTGCCGTGTGAACCATGTGACTTTGTCACAGCCCAAGATAGTTAAGTGGGATCGAGACATGTAAGCAGCATCATGGAGGTTTGAAGATGCCGCATTTGGATTGGATGAATTCCAAATTCTGCTTGCTTGCTTTTTAATATTGATATGCTTATACACTTACACTTTATGCACAAAATGTAGGGTTATAATAATGTTAACATGGACATGATCTTCTTTATAATTCTACTTTGAGTGCTGTCTCCATGTTTGATGTATCTGAGCAGGTTGCTCCACAGGTAGCTCTAGGAGGGCTGGCAACTTAGAGGTGGGGAGCAGAGA

Ensembl | human accession no.

ENSG00000166710

NCBI accession no.

NM_004048

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... B2M(567) , B2M(567)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Egle-Helene Ervin et al.
Stem cell research & therapy, 10(1), 43-43 (2019-01-27)
Human embryonic stem (hES) cells serve as an invaluable tool for research and future medicine, but their transfection often leads to unwanted side effects as the method itself may induce differentiation. On the other hand, RNA interference (RNAi)-based targeted gene
Zaruhi Karabekian et al.
Biomedical materials (Bristol, England), 10(3), 034101-034101 (2015-03-17)
The presence of non-autologous major histocompatibility complex class I (MHC-I) molecules on the surface of the grafted cells is one of the main reasons for their rejection in non-syngeneic hosts. We present a straightforward strategy to decrease the presence of
Matthew E Agwae et al.
Molecular biology reports, 47(5), 3987-3992 (2020-04-03)
iRhom2 is an inactive rhomboid protease involved in diverse signalling events. It has been implicated in the pathogenesis of a number of cancer types, including oesophageal and ovarian cancer, while its closely associated family member, iRhom1, is implicated in head
Marlieke L M Jongsma et al.
Immunity, 54(1), 132-150 (2020-12-04)
HLA class I (HLA-I) glycoproteins drive immune responses by presenting antigens to cognate CD8+ T cells. This process is often hijacked by tumors and pathogens for immune evasion. Because options for restoring HLA-I antigen presentation are limited, we aimed to identify

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico