Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU038211

Sigma-Aldrich

MISSION® esiRNA

targeting human QSOX1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCCAATGTGGTGAGAAAGTTTGGTGTCACCGACTTCCCCTCTTGCTACCTGCTGTTCCGGAATGGCTCTGTCTCCCGAGTCCCCGTGCTCATGGAATCCAGGTCCTTCTATACCGCTTACCTGCAGAGACTCTCTGGGCTCACCAGGGAGGCTGCCCAGACCACAGTTGCACCAACCACTGCTAACAAGATAGCTCCCACTGTTTGGAAATTGGCAGATCGCTCCAAGATCTACATGGCTGACCTGGAATCTGCACTGCACTACATCCTGCGGATAGAAGTGGGCAGGTTCCCGGTCCTGGAAGGGCAGCGCCTGGTGGCCCTGAAAAAGTTTGTGGCAGTGCTGGCCAAGTATTTCCCTGGCCGGCCCTTAGTCCAGAACTTCCTGCACTCCGTGAATGAATGGCTC

Ensembl | nº de acceso humano

ENSG00000116260

Nº de acceso NCBI

NM_002826

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... QSOX1(5768) , QSOX1(5768)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
RIU
QCS
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nicolas Pernodet et al.
Breast cancer research : BCR, 14(5), R136-R136 (2012-10-27)
The gene quiescin/sulfhydryl oxidase 1, QSOX1, encodes an enzyme directed to the secretory pathway and excreted into the extracellular space. QSOX1 participates in the folding and stability of proteins and thus could regulate the biological activity of its substrates in
Yibo Geng et al.
OncoTargets and therapy, 13, 5721-5729 (2020-07-02)
Quiescin sulfhydryl oxidase 1 (QSOX1) involves in the formation of disulfide bonds and participates in the protein folding process. In recent years, accumulating evidences have shown that QSOX1 is a biomarker for tumor development and prognosis. However, the biological function
Yonggang Ma et al.
Journal of neurotrauma, 36(15), 2337-2347 (2019-01-15)
Ependymal cells (EpCs) are a kind of multi-potent stem cells in the central canal of adult spinal cord, which proliferate following spinal cord injury (SCI). Although they can differentiate into functional neurons in vitro, EpC progeny differentiate mainly into astrocytes

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico