Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU037771

Sigma-Aldrich

MISSION® esiRNA

targeting human AQP11

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Fecha estimada de envío09 de mayo de 2025



Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Fecha estimada de envío09 de mayo de 2025


descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAGTATCACGTCAGCGAGAGGAGCTTCGCTTGCAAGAATCCCATCCGAGTCGACTTGCTCAAAGCGGTCATCACAGAGGCCGTCTGCTCCTTTCTCTTCCACAGCGCTCTGCTGCACTTCCAGGAAGTCCGAACCAAGCTTCGTATCCACCTGCTGGCTGCACTCATCACCTTTTTGGTCTATGCAGGAGGAAGTCTAACAGGAGCTGTATTTAATCCAGCTTTGGCACTTTCGCTACATTTCATGTGTTTTGATGAAGCATTCCCTCAGTTTTTTATAGTATACTGGCTGGCTCCTTCTTTAGGTATATTGTTGATGATTTTGATGTTCAGCTTTTTCCTTCCATGGCTGCATAACAACCATACAATTAATAAAAAGGAATAACTGTTCCAAAGACTCAGACTAACATACAGGACAGTCCAGCTGGATGTGATAAAGATTTTATCACCTCATATGGAAAACACCGG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Fuminori Sakurai et al.
Virology journal, 16(1), 58-58 (2019-05-03)
MicroRNAs (miRNAs) have gained much attention as cellular factors regulating hepatitis C virus (HCV) infection. miR-27b has been shown to regulate HCV infection in the hepatocytes via various mechanisms that have not been fully elucidated. In this study, therefore, we
Gema Frühbeck et al.
Cells, 9(6) (2020-06-10)
Aquaporin-11 (AQP11) is expressed in human adipocytes, but its functional role remains unknown. Since AQP11 is an endoplasmic reticulum (ER)-resident protein that transports water, glycerol, and hydrogen peroxide (H2O2), we hypothesized that this superaquaporin is involved in ER stress induced

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico