Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU035581

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCTGACTCTCTGGGCTGTGATCGATTGGGCTGCTTTAACCTCAGCATCCGAGGGCATGGGGAATGCGTTGAATATGTCAAGAGCTTCAATATCCCTCTACTCGTGCTGGGTGGTGGTGGTTATACTGTCCGAAATGTTGCCCGCTGCTGGACATATGAGACATCGCTGCTGGTAGAAGAGGCCATTAGTGAGGAGCTTCCCTATAGTGAATACTTCGAGTACTTTGCCCCAGACTTCACACTTCATCCAGATGTCAGCACCCGCATCGAGAATCAGAACTCACGCCAGTATCTGGACCAGATCCGCCAGACAATCTTTGAAAACCTGAAGATGCTGAACCATGCACCTAGTGTCCAGATTCATGACGTGCCTGCAGACCTCCTGACCTATGACAGGACTGATGAGGCTG

Ensembl | human accession no.

ENSG00000171720

NCBI accession no.

NM_003883

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HDAC3(8841) , HDAC3(8841)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mohammed Ghiboub et al.
Frontiers in immunology, 11, 550769-550769 (2020-10-31)
Histone deacetylases (HDACs) are a group of enzymes that control histone deacetylation and bear potential to direct expression of large gene sets. We determined the effect of HDAC inhibitors (HDACi) on human monocytes and macrophages, with respect to their polarization
Jingzhu Zhang et al.
Frontiers in molecular neuroscience, 10, 395-395 (2017-12-15)
The impairment of amyloid-β (Aβ) clearance in the brain plays a causative role in Alzheimer's disease (AD). Polarity distribution of aquaporin-4 (AQP4) is important to remove Aβ from brain. AQP4 polarity can be influenced by the ratio of two AQP4
Praveen Rajendran et al.
Cancer research, 79(5), 918-927 (2019-01-16)
There continues to be interest in targeting epigenetic "readers, writers, and erasers" for the treatment of cancer and other pathologies. However, a mechanistic understanding is frequently lacking for the synergy observed when combining deacetylase and bromodomain inhibitors. Here we identify
Qin Xu et al.
Inflammation (2018-05-08)
Extracellular high mobility group box 1 (HMGB1) is a lethal pro-inflammatory mediator in endotoxin shock. Hyperacetylation of HMGB1, regulated by histone acetyltransferases (HATs) and histone deacetylases (HDACs), changes its subcellular localization and secretion to the extracellular matrix. Paeonol (2'-hydroxy-4'-methoxyacetophenone), one
A Krell et al.
Neuropathology and applied neurobiology, 45(5), 441-458 (2018-12-15)
Aberrant expression of microRNAs (miRNAs) is frequent in various cancers including gliomas. We aimed to characterize the role of miR-16-5p as a candidate tumour suppressor miRNA in gliomas. Real-time PCR-based approaches were used for miRNA and mRNA expression profiling of
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico