Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU034601

Sigma-Aldrich

MISSION® esiRNA

targeting human GPC5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGAATGAAGACCACCACAAGGAACAGTGAAGAGACGCTTGCCAACAGAAGAAAAGAATTTATCAACAGCCTTCGACTGTACAGGTCATTCTATGGAGGTCTAGCTGATCAGCTTTGTGCTAATGAATTAGCTGCTGCAGATGGACTTCCCTGCTGGAATGGAGAAGATATAGTAAAAAGTTATACTCAGCGTGTGGTTGGAAATGGAATCAAAGCCCAGTCTGGAAATCCTGAAGTCAAAGTCAAAGGAATTGATCCTGTGATAAATCAGATTATTGATAAACTGAAGCATGTTGTTCAGTTGTTACAGGGTAGATCACCCAAACCTGACAAGTGGGAACTTCTTCAGCTGGGCAGTGGTGGAGGCATGGTTGAACAAGTCAGTGGGGACTGTGATGATGAAGATGGTTGCGGGGGATCAGGAAGTGGAGAAGTCAAGAGGACACTGAAGATCACAGACTGGATGCCAGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Masao Takeuchi et al.
PloS one, 16(2), e0226538-e0226538 (2021-02-20)
Glypican-5 (GPC5) is a heparan sulfate proteoglycan (HSPG) localized to the plasma membrane. We previously reported that in the human mesenchymal stem cell line UE6E7T-3, GPC5 is overexpressed in association with transformation and promotes cell proliferation by acting as a
Xin Hong et al.
European journal of pharmacology, 854, 39-47 (2019-04-06)
Accumulating evidence has suggested that Glypican-5 (GPC5) is a tumor suppressor gene in many types of cancers. However, whether GPC5 is involved in glioma remains unknown. This study was designed to explore the expression, biological function and regulatory mechanism of
Koji Okamoto et al.
The American journal of pathology, 185(7), 1889-1898 (2015-05-20)
Type 2 diabetes mellitus is a leading health issue worldwide. Among cases of diabetes mellitus nephropathy (DN), the major complication of type 2 diabetes mellitus, the nephrotic phenotype is often intractable to clinical intervention and demonstrates the rapid decline of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico