Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU034171

Sigma-Aldrich

MISSION® esiRNA

targeting human HOXC13

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Check Cart for Availability


Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Check Cart for Availability

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTCTCTGAGCGCCAGGTAACCATCTGGTTCCAGAACCGGCGGGTCAAAGAGAAGAAGGTGGTCAGCAAATCGAAAGCGCCTCATCTCCACTCCACCTGACCACCCACCCGCTGCTTGCCCCATCTATTTATGTCTCCGCTTTGTACCATAACCGAACCCACGGAAAGACGCTGCGCGGGTGCAGAAGAGTATTTAATGTTAAGGAAAGAGAAGAACCGCGCCGCCCGGAGGCAGAGAGGCTCCATGGCCGTGCTGCTGGGCCATCCCCAACTCCCTATCCCATCCCCAGCCTCCACCCCCATCCAGATGGGACTCACGTGGCTTCAACAGCTTTGGAAATGGGTCCCGAGTGGGCCGTGCGAGGAAGGCTGTCGACCTCTACTCCTCCTTGCGCTCACCTTGCCAGAAAGTC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Li Wu et al.
Experimental cell research, 369(2), 275-283 (2018-05-31)
Vascular endothelial growth factor (VEGF) has been recognized to be a potential pharmaceutical target for treating ischemic stroke, but its severe side effects hinder its widely application. Here, the present study was designed to investigate the effects of VEGF on
Ming Yu et al.
Genesis (New York, N.Y. : 2000), 54(10), 519-533 (2016-10-21)
The mouse zinc-finger gene Zfp521 (also known as ecotropic viral insertion site 3; Evi3; and ZNF521 in humans) has been identified as a B-cell proto-oncogene, causing leukemia in mice following retroviral insertions in its promoter region that drive Zfp521 over-expression.

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico