Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU032191

Sigma-Aldrich

MISSION® esiRNA

targeting human GSDMD

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGTTCTGGAAACCCCGTTATAAGTGTGTCAACCTGTCTATCAAGGACATCCTGGAGCCGGATGCCGCGGAACCAGACGTGCAGCGTGGCAGGAGCTTCCACTTCTACGATGCCATGGATGGGCAGATACAGGGCAGCGTGGAGCTGGCAGCCCCAGGACAGGCAAAGATCGCAGGCGGGGCCGCGGTGTCTGACAGCTCCAGCACCTCAATGAATGTGTACTCGCTGAGTGTGGACCCTAACACCTGGCAGACTCTGCTCCATGAGAGGCACCTGCGGCAGCCAGAACACAAAGTCCTGCAGCAGCTGCGCAGCCGCGGGGACAACGTGTACGTGGTGACTGAGGTGCTGCAGACACAGAAGGAGGTGGAAGTCACGCGCACCCACAAGCGGGAGGGCTCGGGCCGGTTTTCCCTGCCCGGAGCCACGTGCTTGCAGGGTGAGGGCCAGGGCCATCTGAGCCAGAAGAAGACGGTC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Guangxue Gu et al.
International immunopharmacology, 91, 107227-107227 (2020-12-29)
Ankylosing spondylitis (AS) is a disease characterized by inflammation of the sacroiliac joint and the attachment point of the spine. This study aimed to investigate the effect of microRNA (miR)-204-targeted GSDMD on fibroblast-like synoviocytes (FLSs) in AS. miR-204, GSDMD, pyrolysis-related
Jianwei Gao et al.
Oncology reports, 40(4), 1971-1984 (2018-08-15)
Gasdermin D (GSDMD) is a newly discovered pyroptosis executive protein, which can be cleaved by inflammatory caspases and is essential for secretion of IL‑1β, making it a critical mediator of inflammation. However, the precise role of GSDMD in carcinogenesis remains nearly
Hui Chen et al.
Molecular neurodegeneration, 15(1), 26-26 (2020-04-17)
Acute glaucoma, characterized by a sudden elevation in intraocular pressure (IOP) and retinal ganglion cells (RGCs) death, is a major cause of irreversible blindness worldwide that lacks approved effective therapies, validated treatment targets and clear molecular mechanisms. We sought to
Wenyi Zhao et al.
Experimental eye research, 202, 108375-108375 (2020-12-07)
The protein GSDMD is an important performer of pyroptosis and a universal substrate for the inflammatory caspase. However, the role and regulatory mechanism of GSDMD in Aspergillus fumigatus keratitis is remains unknown. Here we detected GSDMD protein in the cornea

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico