Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU030731

Sigma-Aldrich

MISSION® esiRNA

targeting human NEU3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAACCCAAGCCAATTCAAAAGCAATTAATTGGCTTAGGACCCAATTTCCATAGATGCAAATGGCAGTTACAGACAGGTTAACAGAAGCTACTGAAGTCTACAGATAATCAAAAAACTTAATATTCTGTTCCCTACCTTTTTTCACTTTTCCTCCTCCAAAGAGCAAAATGAAAATTTTGCCTTAGCTACTGCAGTGGAAAGAGCACTGAACTAGGAGTTGGAAGACAAGGATGTGGTCCTGGCTCTGCCACTGGCTTGCTTTTGGACCTTGGATGTGTCACCTGAACTCTCTGGACCTCAGGTTTCCATCTGTAAAATGAGAGTATTGGTTCTAAGATTTCTCATCTTCTCATCCCTAGGACAAGCATAGTGCCTGCATGCTTCATGATCAGTAAGTCCTGGCTGCATAAAGGA

Ensembl | nº de acceso humano

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Md Amran Howlader et al.
ACS chemical biology, 15(6), 1328-1339 (2020-04-21)
The human neuraminidase enzymes (NEU1, NEU2, NEU3, and NEU4) are a class of enzymes implicated in pathologies including cancer and diabetes. Several reports have linked neuraminidase activity to the regulation of cell migration in cancer cells. Using an in vitro
Kazuhiro Shiozaki et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 29(5), 2099-2111 (2015-02-14)
The plasma membrane-associated sialidase NEU3 plays crucial roles in regulation of transmembrane signaling, and its aberrant up-regulation in various cancers contributes to malignancy. However, it remains uncertain how NEU3 is naturally activated and locates to plasma membranes, because of its

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico