Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU029551

Sigma-Aldrich

MISSION® esiRNA

targeting human PIWIL4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Fecha estimada de envío25 de mayo de 2025



Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Fecha estimada de envío25 de mayo de 2025


descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGCTGCCATCAAGTTCTCCCGTGTGCATCCAGGTCTTCAATATCATCTTCAGAAAGATCCTCAAAAAGTTGTCCATGTACCAAATTGGACGGAACTTCTATAATCCTTCAGAGCCAATGGAAATTCCCCAGCACAAATTATCCCTTTGGCCTGGGTTTGCCATTTCTGTGTCATATTTTGAAAGGAAGCTCCTGTTTAGTGCTGATGTGAGTTACAAAGTCCTCCGGAATGAGACGGTTCTGGAATTCATGACTGCTCTCTGTCAAAGAACTGGCTTGTCCTGTTTCACCCAGACGTGTGAGAAGCAGCTAATAGGGCTCATTGTCCTTACAAGATACAATAACAGAACCTACTCCATTGATGACATTGACTGGTCAGTGAAGCCCACACACACCTTTCAGAAGCGGGATGGCACCGAGATCACCTATGTGGATTACTACAAGCAGCAGTATGATATTACTGTATCGGACCTGAATCAGCC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zealyn Shi Lin Heng et al.
Oncology reports, 40(5), 2525-2535 (2018-09-19)
A majority of breast cancer cases are positive for the estrogen receptor (ER), which means that they can respond to the estrogen hormone to achieve growth. Hence, the ER signaling pathway has been extensively targeted in pharmaceutical research and development
Charannya Sozheesvari Subhramanyam et al.
RNA biology, 17(11), 1613-1624 (2020-05-07)
PIWI homologs constitute a subclass of the Argonaute family. Traditionally, they have been shown to associate with a specific class of small RNAs, piRNAs, to suppress transposable elements and protect genomic integrity in germ cells. Recent studies imply that PIWI

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico