Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU027341

Sigma-Aldrich

MISSION® esiRNA

targeting human DDB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCACCGTCACTCTCAAGGATCTCCGTGTAGAACTCCTTGGAGAGACCTCTATTGCTGAGTGCTTGACATACCTTGATAATGGTGTTGTGTTTGTCGGGTCTCGCCTGGGTGACTCCCAGCTTGTGAAGCTCAACGTTGACAGTAATGAACAAGGCTCCTATGTAGTGGCCATGGAAACCTTTACCAACTTAGGACCCATTGTCGATATGTGCGTGGTGGACCTGGAGAGGCAGGGGCAGGGGCAGCTGGTCACTTGCTCTGGGGCTTTCAAGGAAGGTTCTTTGCGGATCATCCGGAATGGAATTGGAATCCACGAGCATGCCAGCATTGACTTACCAGGCATCAAAGGATTATGGCCACTGCGGTCTGACCCTAATCGTGAGACTGATGACACTTTGGTGCTCTCTTTTGTGGGCCAGACAAGAGTTCTCATGTTAAATGGAGAGGAGGTAGAAGAAACCGAACTGATGGGTTTCGTGGATGATC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hiroaki Kawara et al.
Biochemical and biophysical research communications, 519(1), 204-210 (2019-09-09)
The ERCC1-XPF heterodimer is a structure-specific endonuclease and plays multiple roles in various DNA repair pathways including nucleotide excision repair and also telomere maintenance. The dimer formation, which is mediated by their C-terminal helix-hairpin-helix regions, is essential for their endonuclease
Huiming Lu et al.
Nature communications, 8(1), 2039-2039 (2017-12-13)
Pathway choice within DNA double-strand break (DSB) repair is a tightly regulated process to maintain genome integrity. RECQL4, deficient in Rothmund-Thomson Syndrome, promotes the two major DSB repair pathways, non-homologous end joining (NHEJ) and homologous recombination (HR). Here we report
Qiuling Li et al.
The Journal of biological chemistry, 290(35), 21553-21567 (2015-07-15)
Pygopus 2 (Pygo2/PYGO2) is an evolutionarily conserved coactivator and chromatin effector in the Wnt/β-catenin signaling pathway that regulates cell growth and differentiation in various normal and malignant tissues. Although PYGO2 is highly overexpressed in a number of human cancers, the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico