Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU027141

Sigma-Aldrich

MISSION® esiRNA

targeting human PTN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGTGCAAGCAAACCATGAAGACCCAGAGATGTAAGATCCCCTGCAACTGGAAGAAGCAATTTGGCGCGGAGTGCAAATACCAGTTCCAGGCCTGGGGAGAATGTGACCTGAACACAGCCCTGAAGACCAGAACTGGAAGTCTGAAGCGAGCCCTGCACAATGCCGAATGCCAGAAGACTGTCACCATCTCCAAGCCCTGTGGCAAACTGACCAAGCCCAAACCTCAAGCAGAATCTAAGAAGAAGAAAAAGGAAGGCAAGAAACAGGAGAAGATGCTGGATTAAAAGATGTCACCTGTGGAACATAAAAAGGACATCAGCAAACAGGATCAGTTAACTATTGCATTTATATGTACCGTAGGCTTTGTATTCAAAAATTATCTATAGCTAAGTACACAATAAGCAAAAACAAAAAGAAAAGAAAATTTTTGTAGTAGCGTTTTTTAAATGTATACTATAGTACCAGTAGGGGCTTATAATAAAGGA

Ensembl | nº de acceso humano

ENSG00000105894

Nº de acceso NCBI

NM_002825

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PTN(5764) , PTN(5764)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
HVR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Biqiang Zhu et al.
Cancer medicine, 9(2), 783-796 (2020-01-21)
Cholangiocarcinoma is a malignant tumor originating from bile duct epithelium. Currently, the treatment strategy is very limited and the prognosis is poor. Recent studies reported celastrol exhibits antigrowth and antimetastasis properties in many tumors. Our study aimed to assess the
Xingxing Sun et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 128, 110201-110201 (2020-05-28)
Opa-interacting protein 5 antisense RNA1 (OIP5-AS1) has been demonstrated to facilitate proliferation, metastasis and resistance to treatments in various types of cancers. Nevertheless, the exact mechanisms underlying the roles of OIP5-AS1 in osteosarcoma(OS) drug resistance have not yet been clearly
Xue Ding et al.
Graefe's archive for clinical and experimental ophthalmology = Albrecht von Graefes Archiv fur klinische und experimentelle Ophthalmologie, 255(5), 873-884 (2017-01-14)
The purpose of our study was to investigate the effects of pleiotrophin (PTN) in proliferative vitreoretinopathy (PVR) both in vitro and in vivo. Immunofluorescence was used to observe the PTN expression in periretinal membrane samples from patients with PVR and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico