Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU026681

Sigma-Aldrich

MISSION® esiRNA

targeting human TSPAN8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
En este momento no podemos mostrarle ni los precios ni la disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCTCCAGAGCATATTGCAGGACAAGCCTGTAACGAATAGTTAAATTCACGGCATCTGGATTCCTAATCCTTTTCCGAAATGGCAGGTGTGAGTGCCTGTATAAAATATTCTATGTTTACCTTCAACTTCTTGTTCTGGCTATGTGGTATCTTGATCCTAGCATTAGCAATATGGGTACGAGTAAGCAATGACTCTCAAGCAATTTTTGGTTCTGAAGATGTAGGCTCTAGCTCCTACGTTGCTGTGGACATATTGATTGCTGTAGGTGCCATCATCATGATTCTGGGCTTCCTGGGATGCTGCGGTGCTATAAAAGAAAGTCGCTGCATGCTTCTGTTGTTTTTCATAGGCTTGCTTCTGATCCTGCTCCTGCAGGTGGCGACAGGTATCCTAGGAGCTGTTTTCAAATCTAAGTCTGATCGCATTGTGAATGAAACTCTCTATGAAAACACAAAGCTTTTGAGCGCCACAGGGGAAAGTGAAAAA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Manale El Kharbili et al.
Oncotarget, 8(10), 17140-17155 (2017-02-12)
Melanoma is well known for its propensity for lethal metastasis and resistance to most current therapies. Tumor progression and drug resistance depend to a large extent on the interplay between tumor cells and the surrounding matrix. We previously identified Tetraspanin
Manale El Kharbili et al.
Oncogene, 38(20), 3781-3793 (2019-01-27)
Due to its high proclivity to metastasize, and despite the recent development of targeted and immune therapy strategies, melanoma is still the deadliest form of skin cancer. Therefore, understanding the molecular mechanisms underlying melanoma invasion remains crucial. We previously characterized
Lunshou Wei et al.
International journal of clinical and experimental medicine, 8(6), 8599-8607 (2015-08-27)
This study was designed to investigate the effects of Tetraspanin 8 (TSPAN8) overexpression and TSPAN8 suppression on gastric cancer cell proliferation and invasion. Furthermore, whether extracellular-signal regulated kinase (ERK) mitogen-activated protein kinase (MAPK) pathway was involved in TSPAN8's function on

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico