Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU023531

Sigma-Aldrich

MISSION® esiRNA

targeting human RB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCATGGCTCTCAGATTCACCTTTATTTGATCTTATTAAACAATCAAAGGACCGAGAAGGACCAACTGATCACCTTGAATCTGCTTGTCCTCTTAATCTTCCTCTCCAGAATAATCACACTGCAGCAGATATGTATCTTTCTCCTGTAAGATCTCCAAAGAAAAAAGGTTCAACTACGCGTGTAAATTCTACTGCAAATGCAGAGACACAAGCAACCTCAGCCTTCCAGACCCAGAAGCCATTGAAATCTACCTCTCTTTCACTGTTTTATAAAAAAGTGTATCGGCTAGCCTATCTCCGGCTAAATACACTTTGTGAACGCCTTCTGTCTGAGCACCCAGAATTAGAACATATCATCTGGACCCTTTTCCAGCACACCCTGCAGAATGAGTATGAACTCATGAGAGACAGGCATTTGGACC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Toshiyuki Sumi et al.
Biochemical and biophysical research communications, 501(1), 253-258 (2018-05-05)
High expression levels of survivin in KRAS-mutant lung adenocarcinomas are linked with unfavorable patient outcomes, suggesting that survivin is a promising target for tumor treatment. We found that trametinib, a MEK inhibitor, downregulates survivin expression in the RB1-positive KRAS-mutant lung
Chun-Yu Liu et al.
PloS one, 12(12), e0189007-e0189007 (2017-12-21)
Triple negative breast cancer (TNBC) lacks specific drug targets and remains challenging. Palbociclib, a cyclin-dependent kinases 4 and 6 (CDK4/6) inhibitor is approved for metastatic estrogen receptor (ER)-positive and human epithermal growth factor 2 (HER2)-negative breast cancer. The nature of
Elisabetta Marangoni et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(11), 2605-2615 (2018-02-22)
Purpose: Triple-negative breast cancer (TNBC) patients with residual disease after neoadjuvant chemotherapy have a poor outcome. We developed patient-derived xenografts (PDX) from residual tumors to identify efficient chemotherapies and predictive biomarkers in a context of resistance to anthracyclines- and taxanes-based
Karen McColl et al.
Oncotarget, 8(43), 73745-73756 (2017-11-02)
The majority of small cell lung cancer (SCLC) patients demonstrate initial chemo-sensitivity, whereas a distinct subgroup of SCLC patients, termed chemo-refractory, do not respond to treatment. There is little understanding of how to distinguish these patients prior to disease treatment.
Gabrielle van Caloen et al.
Molecular cancer therapeutics, 19(3), 777-789 (2020-01-12)
Cell-cycle pathway impairments resulting in CDK4 and 6 activation are frequently observed in human papillomavirus (HPV)-negative squamous cell carcinoma of the head and neck (SCCHN). We investigated the activity of ribociclib, a CDK4/6 inhibitor, in SCCHN models with the aim

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico