Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU023141

Sigma-Aldrich

MISSION® esiRNA

targeting human XPA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
En este momento no podemos mostrarle ni los precios ni la disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATGCGAAGAATGTGGGAAAGAATTTATGGATTCTTATCTTATGAACCACTTTGATTTGCCAACTTGTGATAACTGCAGAGATGCTGATGATAAACACAAGCTTATAACCAAAACAGAGGCAAAACAAGAATATCTTCTGAAAGACTGTGATTTAGAAAAAAGAGAGCCACCTCTTAAATTTATTGTGAAGAAGAATCCACATCATTCACAATGGGGTGATATGAAACTCTACTTAAAGTTACAGATTGTGAAGAGGTCTCTTGAAGTTTGGGGTAGTCAAGAAGCATTAGAAGAAGCAAAGGAAGTCCGACAGGAAAACCGAGAAAAAATGAAACAGAAGAAATTTGATAAAAAAGTAAAAGAATTGCGGCGAGCAGTAAGAAGCAGCGTGTGGAAAAGGGAGACGATTGTTCATCAACATGAGTATGGACCAGAAGAAAACCTAGAAGATGACATGTACCGTAAGACTTGTACTATGTGTGGCCATGAACTGAC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yi Wen Kong et al.
Nature communications, 11(1), 4124-4124 (2020-08-19)
In response to DNA damage, a synthetic lethal relationship exists between the cell cycle checkpoint kinase MK2 and the tumor suppressor p53. Here, we describe the concept of augmented synthetic lethality (ASL): depletion of a third gene product enhances a
Alaina R Martinez et al.
Genes, chromosomes & cancer, 56(8), 617-631 (2017-04-12)
Cancer cells require telomere maintenance to enable uncontrolled growth. Most often telomerase is activated, although a subset of human cancers are telomerase-negative and depend on recombination-based mechanisms known as ALT (Alternative Lengthening of Telomeres). ALT depends on proteins that are
Mariangela Sabatella et al.
Cellular and molecular life sciences : CMLS, 77(10), 2005-2016 (2019-08-09)
The effectiveness of many DNA-damaging chemotherapeutic drugs depends on their ability to form monoadducts, intrastrand crosslinks and/or interstrand crosslinks (ICLs) that interfere with transcription and replication. The ERCC1-XPF endonuclease plays a critical role in removal of these lesions by incising

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico