Saltar al contenido
Merck

EHU017831

Sigma-Aldrich

MISSION® esiRNA

targeting human SOS1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
En este momento no podemos mostrarle ni los precios ni la disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCCACAGTTGAGTGGCATATAAGCAGACCTGGGCACATAGAGACTTTTGACCTGCTCACCTTACACCCAATAGAAATTGCTCGACAACTCACTTTACTTGAATCAGATCTATACCGAGCTGTACAGCCATCAGAATTAGTTGGAAGTGTGTGGACAAAAGAAGACAAAGAAATTAACTCTCCTAATCTTCTGAAAATGATTCGACATACCACCAACCTCACTCTGTGGTTTGAGAAATGTATTGTAGAAACTGAAAATTTAGAAGAAAGAGTAGCTGTGGTGAGTCGAATTATTGAGATTCTACAAGTCTTTCAAGAGTTGAACAACTTTAATGGTGTCCTTGAGGTTGTCAGTGCTATGAATTCATCACCTGTTTACAGACTAGACCACACATTTGAGCAAATACCAAGTCGCCAGAAGAAAA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Manish Mishra et al.
Antioxidants & redox signaling, 30(13), 1621-1634 (2018-08-15)
Diabetes increases oxidative stress in the retina and dysfunctions their mitochondria, accelerating capillary cell apoptosis. A 66 kDa adaptor protein, p66Shc, is considered as a sensor of oxidative stress-induced apoptosis. In the pathogenesis of diabetic retinopathy, a progressive disease, reactive oxygen
Li Ren Kong et al.
Molecular cancer therapeutics, 14(7), 1750-1760 (2015-05-06)
Genomic analyses of squamous cell carcinoma (SCC) have yet to yield significant strategies against pathway activation to improve treatment. Platinum-based chemotherapy remains the mainstay of treatment for SCC of different histotypes either as a single-agent or alongside other chemotherapeutic drugs

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico