Saltar al contenido
Merck

EHU017331

Sigma-Aldrich

MISSION® esiRNA

targeting human TIMP2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGCGGTCAGTGAGAAGGAAGTGGACTCTGGAAACGACATTTATGGCAACCCTATCAAGAGGATCCAGTATGAGATCAAGCAGATAAAGATGTTCAAAGGGCCTGAGAAGGATATAGAGTTTATCTACACGGCCCCCTCCTCGGCAGTGTGTGGGGTCTCGCTGGACGTTGGAGGAAAGAAGGAATATCTCATTGCAGGAAAGGCCGAGGGGGACGGCAAGATGCACATCACCCTCTGTGACTTCATCGTGCCCTGGGACACCCTGAGCACCACCCAGAAGAAGAGCCTGAACCACAGGTACCAGATGGGCTGCGAGTGCAAGATCACGCGCTGCCCCATGATCCCGTGCTACATCTCCTCCCCGGACGAGTGCCTCTGGATGGACTGGGTCACAGAGAAGAACATCAACGGGCACCAGGCCAAGTTCTTCGCCTGCATCAAGAGAAGTGACGGCTCCTGTGCGTGGTACCGCGGCGCGGCGCCCCCCAAGCAGGAGTTTCTCGAC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hao Guan et al.
PloS one, 12(12), e0189490-e0189490 (2017-12-09)
MicroRNAs (miRNAs) are important regulators of pathobiological processes in various cancer. In the present study, we demonstrated that miR-93 expression was significantly up-regulated in gastric cancer tissues compared with that in matched normal mucosal tissues. High expression of miR-93 was
Yuan Cheng et al.
Molecular medicine reports, 16(4), 5464-5470 (2017-08-30)
Human papillomavirus (HPV) infection alone is not sufficient for development of cervical cancer and further risk factors are involved, however, the underlying mechanism remains to be elucidated. The authors previously used a microarray assay to reveal microR‑20b (miR‑20b) as a key
Yinghua Guo et al.
The international journal of biochemistry & cell biology, 99, 203-210 (2018-04-21)
Radiotherapy is a widely used effective treatment for lung cancer in clinic. MicroRNAs (miRNAs) have been proved to play an important role in radiation response. This study aimed to explore the regulatory role and mechanism of miR-373 in lung cancer
Shanlan Yin et al.
Experimental and therapeutic medicine, 17(4), 2837-2846 (2019-03-25)
Human papillomaviruses (HPVs) have important roles in the development and progression of cervical cancer, but the underlying mechanisms are yet to be fully elucidated. MicroRNA-130a (miR-130a) has previously been reported to promote cervical cancer growth. However, the underlying molecular mechanisms
Guijun Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 118, 109309-109309 (2019-09-24)
To explore the roles of long noncoding RNA (lncRNA) FOXF1 Adjacent Non-Coding Developmental Regulatory RNA (FENDRR) in human non-small cell lung cancer (NSCLC). The levels of FENDRR in NSCLC cells and tissues were analyzed using qRT-PCR assay. The growth and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico