Saltar al contenido
Merck

EHU016311

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNH8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCAGATGAACTGCGTTCTGACATCACTATGCACTTGAACAAGGAGATCTTACAGTTGTCCCTTTTTGAATGTGCCAGCCGGGGCTGCCTCAGGTCTCTGTCTCTACACATCAAAACCTCTTTCTGTGCTCCGGGGGAGTATCTGCTGCGTCAAGGGGATGCTTTGCAGGCCATCTACTTTGTATGCTCGGGCTCCATGGAAGTTCTTAAAGACAGCATGGTGCTGGCTATTCTTGGGAAAGGGGATTTAATTGGAGCAAATCTATCAATTAAGGACCAAGTGATCAAGACCAATGCAGATGTAAAGGCTTTAACCTACTGTGATCTCCAGTGTATCATCCTCAAAGGACTCTTTGAAGTGCTAGACCTTTACCCAGAATATGCTCACAAATTCGTGGAAGACATTCAGCATGACCTCACATACAACCTCCGAGAAGGTCATGAGAGTGATGTGATATCAAGACTATCAAACAAATCTATGGTCTCACAGTCAGAGCCCAAGGGAAAT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chrisostomos Chrisostomidis et al.
International journal of dermatology, 54(9), 989-995 (2015-07-16)
The aim of this study was to investigate if the expression of CD105 and Ets-1 was predictive of aggressive biologic behavior of non-melanoma skin cancers (NMSC) and to evaluate indicators of local recurrence. A total of 144 patients with NMSC
Velidi H Rao et al.
American journal of physiology. Heart and circulatory physiology, 309(6), H1075-H1086 (2015-08-09)
Although degradation of extracellular matrix by matrix metalloproteinases (MMPs) is thought to be involved in symptomatic (S) carotid plaques in atherosclerosis, the mechanisms of MMP expression are poorly understood. Here, we demonstrate that collagen loss in vascular smooth vessel cells
E Douglas Robertson et al.
PloS one, 9(11), e113050-e113050 (2014-11-18)
The molecular response to hypoxia is a critical cellular process implicated in cancer, and a target for drug development. The activity of the major player, HIF1α, is regulated at different levels by various factors, including the transcription factor ELK3. The

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico