Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU015991

Sigma-Aldrich

MISSION® esiRNA

targeting human SSRP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
En este momento no podemos mostrarle ni los precios ni la disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCAAACTCGCTACCACTTCCTGATCCTCCTCTTCTCCAAGGACGAGGACATTTCGTTGACTCTGAACATGAACGAGGAAGAAGTGGAGAAGCGCTTTGAGGGTCGGCTCACCAAGAACATGTCAGGATCCCTCTATGAGATGGTCAGCCGGGTCATGAAAGCACTGGTAAACCGCAAGATCACAGTGCCAGGCAACTTCCAAGGGCACTCAGGGGCCCAGTGCATTACCTGTTCCTACAAGGCAAGCTCAGGACTGCTCTACCCGCTGGAGCGGGGCTTCATCTACGTCCACAAGCCACCTGTGCACATCCGCTTCGATGAGATCTCCTTTGTCAACTTTGCTCGTGGTACCACTACTACTCGTTCCTTTGACTTTGAAATTGAGACCAAGCAGGGCACTCAGTATACCTTCAGCAGCATTGAGAGGGAGGAGTACGGGAAACTGTTTGATTTTGTCAACGCGAAAAAGCTCAACATCAAAAACCGAGGATTGAAAGAGGGCATGAA

Ensembl | nº de acceso humano

ENSG00000149136

Nº de acceso NCBI

NM_003146

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SSRP1(6749) , SSRP1(6749)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
YDV
FAV
RXU
SWU
BWU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wenyong Long et al.
Journal of molecular cell biology, 10(2), 147-160 (2018-02-17)
The differentiation status of neuroblastoma (NB) strongly correlates with its clinical outcomes; however, the molecular mechanisms driving maintenance of stemness and differentiation remain poorly understood. Here, we show that plant homeodomain finger-containing protein 20 (PHF20) functions as a critical epigenetic
Alan S Wang et al.
Molecular cell, 79(2), 221-233 (2020-07-01)
Cas9 is a prokaryotic RNA-guided DNA endonuclease that binds substrates tightly in vitro but turns over rapidly when used to manipulate genomes in eukaryotic cells. Little is known about the factors responsible for dislodging Cas9 or how they influence genome engineering.
Ying Gao et al.
Cancer research, 77(10), 2674-2685 (2017-04-19)
DNA single-strand breaks (SSB) are the most common form of DNA damage, requiring repair processes that to initiate must overcome chromatin barriers. The FACT complex comprised of the SSRP1 and SPT16 proteins is important for maintaining chromatin integrity, with SSRP1
Miranda M Tallman et al.
Cancer letters, 499, 232-242 (2020-12-01)
Glioblastoma (GBM) is an incurable brain tumor with inevitable recurrence. This is in part due to a highly malignant cancer stem cell (CSC) subpopulation of tumor cells that is particularly resistant to conventional treatments, including radiotherapy. Here we show that
Ling Bi et al.
International journal of cancer, 145(1), 164-178 (2018-12-15)
Cancer cell repopulation through cell cycle re-entry by quiescent (G0 ) cell is thought to be an important mechanism behind treatment failure and cancer recurrence. Facilitates Chromatin Transcription (FACT) is involved in DNA repair, replication and transcription by eviction of

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico