Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU014941

Sigma-Aldrich

MISSION® esiRNA

targeting human ABL2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
En este momento no podemos mostrarle ni los precios ni la disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGCGTCTGGAAGAAATACAGCCTTACAGTTGCTGTGAAAACATTGAAGGAAGATACCATGGAGGTAGAAGAATTCCTGAAAGAAGCTGCAGTAATGAAGGAAATCAAGCATCCTAATCTGGTACAACTTTTAGGTGTGTGTACTTTGGAGCCACCATTTTACATTGTGACTGAATACATGCCATACGGGAATTTGCTGGATTACCTCCGAGAATGCAACCGAGAAGAGGTGACTGCAGTTGTGCTGCTCTACATGGCCACTCAGATTTCTTCTGCAATGGAGTACTTAGAGAAGAAGAATTTCATCCATAGAGATCTTGCAGCTCGTAACTGCCTAGTGGGAGAAAACCATGTGGTAAAAGTGGCTGACTTTGGCTTAAGTAGATTGATGACTGGAGACACTTATACTGCTCATGCTGGAGCCAAATTTCCTATTAAGTGGACAGCACCAGAGAGTCTTGCCTACAATACCTTCTCAATTAAATCTGACGTCTGGGCTTTTGGGGTATT

Ensembl | nº de acceso humano

ENSG00000143322

Nº de acceso NCBI

NM_007314

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ABL2(27) , ABL2(27)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
JUU
IDU
ALT
QCS
NRR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

H Gil-Henn et al.
Oncogene, 32(21), 2622-2630 (2012-07-11)
Tumor progression is a complex, multistep process involving accumulation of genetic aberrations and alterations in gene expression patterns leading to uncontrolled cell division, invasion into surrounding tissue and finally dissemination and metastasis. We have previously shown that the Arg/Abl2 non-receptor
Xiu-Fen Ming et al.
Journal of the American Heart Association, 1(4), e000992-e000992 (2012-11-07)
Macrophage-mediated chronic inflammation is mechanistically linked to insulin resistance and atherosclerosis. Although arginase I is considered antiinflammatory, the role of arginase II (Arg-II) in macrophage function remains elusive. This study characterizes the role of Arg-II in macrophage inflammatory responses and
Takafumi Ichikawa et al.
Journal of cell science, 130(20), 3517-3531 (2017-09-03)
Vinexin, c-Cbl associated protein (CAP) and Arg-binding protein 2 (ArgBP2) constitute an adaptor protein family called the vinexin (SORBS) family that is targeted to focal adhesions (FAs). Although numerous studies have focused on each of the SORBS proteins and partially
Alicia N Rizzo et al.
Vascular pharmacology, 128-129, 106677-106677 (2020-04-03)
Acute Respiratory Distress Syndrome (ARDS) is a devastating disease process that involves dysregulated inflammation and decreased alveolar-capillary barrier function. Despite increased understanding of the pathophysiology, no effective targeted therapies exist to treat ARDS. Recent preclinical studies suggest that the multi-tyrosine
Alessandro Genna et al.
The Journal of cell biology, 217(1), 375-395 (2017-11-15)
The nonreceptor tyrosine kinase Pyk2 is highly expressed in invasive breast cancer, but the mechanism by which it potentiates tumor cell invasiveness is unclear at present. Using high-throughput protein array screening and bioinformatic analysis, we identified cortactin as a novel
Ver todos los artículos relacionados

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico