Saltar al contenido
Merck

EHU013761

Sigma-Aldrich

MISSION® esiRNA

targeting human THRA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAGATGGAAAGCGAAAAAGAAAGAACGGCCAATGTTCCCTGAAAACCAGCATGTCAGGGTATATCCCTAGTTACCTGGACAAAGACGAGCAGTGTGTCGTGTGTGGGGACAAGGCAACTGGTTATCACTACCGCTGTATCACTTGTGAGGGCTGCAAGGGCTTCTTTCGCCGCACAATCCAGAAGAACCTCCATCCCACCTATTCCTGCAAATATGACAGCTGCTGTGTCATTGACAAGATCACCCGCAATCAGTGCCAGCTGTGCCGCTTCAAGAAGTGCATCGCCGTGGGCATGGCCATGGACTTGGTTCTAGATGACTCGAAGCGGGTGGCCAAGCGTAAGCTGATTGAGCAGAACCGGGAGCGGCGGCGGAAGGAGGAGATGATCCGATCACTGCAGCAGCGACCAGAGCCCACTCCTGAAGAG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kabsun Kim et al.
Molecules and cells, 43(1), 34-47 (2020-01-04)
The circadian clock regulates various physiological processes, including bone metabolism. The nuclear receptors Reverbs, comprising Rev-erbα and Rev-erbβ, play a key role as transcriptional regulators of the circadian clock. In this study, we demonstrate that Rev-erbs negatively regulate differentiation of
Zhen Qiu et al.
Cell death & disease, 12(1), 43-43 (2021-01-09)
The circadian clock is closely related to the development of diabetes mellitus and cardiovascular disease, and disruption of the circadian clock exacerbates myocardial ischaemia/reperfusion injury (MI/RI). HDAC3 is a key component of the circadian negative feedback loop that controls the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico