Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU013041

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM4A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTGCAGGCCAGAAAGTCATTAGCAAGCATAAGAACGGGCGCTTCTACCAGTGTGAAGTGGTCAGGCTCACCACCGAGACCTTCTATGAAGTCAACTTTGATGATGGCTCCTTCAGCGACAATCTTTATCCTGAGGACATAGTGAGCCAGGACTGTCTCCAGTTTGGTCCTCCTGCTGAAGGGGAAGTGGTCCAAGTGAGATGGACAGACGGCCAAGTCTATGGAGCCAAGTTTGTGGCCTCCCACCCTATCCAAATGTACCAGGTGGAGTTTGAGGATGGCTCACAACTTGTGGTTAAGAGAGATGATGTATACACACTGGATGAAGAGCTTCCCAAGAGAGTCAAATCTAGACTGTCAGTAGCCTCAGACATGCGCTTCAATGAGATTTTCACAGAGAAAGAGGTTAAGCAAGAAAAGAAACGGCAA

Ensembl | human accession no.

ENSG00000066135

NCBI accession no.

NM_014663

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KDM4A(9682) , JMJD2A(9682)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yi Su et al.
BMC cancer, 17(1), 477-477 (2017-07-12)
Jumonji C domain 2A (JMJD2A), as a histone demethylases, plays a vital role in tumorigenesis and progression. But, its functions and underlying mechanisms of JMJD2A in nasopharyngeal carcinoma (NPC) metabolism are remained to be clarified. In this study, we investigated
Antonio Pezone et al.
Nucleic acids research, 48(16), 8943-8958 (2020-07-23)
The epithelial-to-mesenchymal transition (EMT) is a complex transcriptional program induced by transforming growth factor β1 (TGF-β1). Histone lysine-specific demethylase 1 (LSD1) has been recognized as a key mediator of EMT in cancer cells, but the precise mechanism that underlies the
Haiyu Zhang et al.
Archives of biochemistry and biophysics, 684, 108334-108334 (2020-03-17)
Emerging evidence shows that histone modification and its related regulators are involved in the progression and chemoresistance of ovarian cancer (OC) cells. Our present study found that the expression of Jumonji C domain-containing 2A (JMJD2A), while not JMJD2B or JMJD2C
Tadahiko Nakagawa et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 23(3), 426-436 (2019-11-05)
Jumonji domain-containing protein 2A (JMJD2A) of the JMJD2 family of histone lysine demethylases has been implicated in tumorigenesis. However, its expression and role in gastric cancer (GC) drug resistance remain unknown. Here, we investigated the role of JMJD2A in GC

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico