Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU012621

Sigma-Aldrich

MISSION® esiRNA

targeting human POLD3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTGGTGTCTGGCAGTCTCATTCAGAATGGACATTCCTGCCACAAGGTTGCAGTAGTGAGAGAAGATAAATTGGAAGCAGTGAAGTCCAAGCTAGCTGTGACTGCCAGCATCCATGTGTACAGCATCCAGAAAGCCATGCTAAAGGACAGTGGGCCTCTGTTCAATACTGACTATGACATCCTTAAAAGCAACTTGCAGAACTGCAGCAAATTTAGTGCTATACAATGTGCAGCTGCCGTCCCTAGAGCTCCTGCTGAATCCTCTTCGTCTTCCAAAAAGTTTGAGCAGTCACATCTTCACATGTCAAGTGAGACACAAGCCAACAATGAGCTGACCACCAATGGTCATGGCCCACCTGCATCCAAGCAGGTTTCCCAGCAGCCCAAAGGAATTATGGGAATGTTTGCCTCCAAAGCTGCTGCTAAAACC

Ensembl | human accession no.

ENSG00000077514

NCBI accession no.

NM_006591

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... POLD3(10714) , POLD3(10714)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xianning Lai et al.
Nature communications, 8, 15983-15983 (2017-07-18)
Failure to restart replication forks stalled at genomic regions that are difficult to replicate or contain endogenous DNA lesions is a hallmark of BRCA2 deficiency. The nucleolytic activity of MUS81 endonuclease is required for replication fork restart under replication stress
Robert L Dilley et al.
Nature, 539(7627), 54-58 (2016-11-04)
Homology-directed DNA repair is essential for genome maintenance through templated DNA synthesis. Alternative lengthening of telomeres (ALT) necessitates homology-directed DNA repair to maintain telomeres in about 10-15% of human cancers. How DNA damage induces assembly and execution of a DNA
Emanuela Tumini et al.
Scientific reports, 6, 38873-38873 (2016-12-16)
DNA replication is essential for cellular proliferation. If improperly controlled it can constitute a major source of genome instability, frequently associated with cancer and aging. POLD1 is the catalytic subunit and POLD3 is an accessory subunit of the replicative Pol
Sheroy Minocherhomji et al.
Nature, 528(7581), 286-290 (2015-12-04)
Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico