Saltar al contenido
Merck

EHU012511

Sigma-Aldrich

MISSION® esiRNA

targeting human ST14

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACGTCCTGCTCATCACACTGATAACCAACACTGAGCGGCGGCATCCCGGCTTTGAGGCCACCTTCTTCCAGCTGCCTAGGATGAGCAGCTGTGGAGGCCGCTTACGTAAAGCCCAGGGGACATTCAACAGCCCCTACTACCCAGGCCACTACCCACCCAACATTGACTGCACATGGAACATTGAGGTGCCCAACAACCAGCATGTGAAGGTGCGCTTCAAATTCTTCTACCTGCTGGAGCCCGGCGTGCCTGCGGGCACCTGCCCCAAGGACTACGTGGAGATCAACGGGGAGAAATACTGCGGAGAGAGGTCCCAGTTCGTCGTCACCAGCAACAGCAACAAGATCACAGTTCGCTTCCACTCAGATCAGTCCTACACCGACACCGGCTTCTTAGCTGAATACCTCTCCTACGACTCCAGTGACCCATG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chuan-Jin Wu et al.
The Journal of clinical investigation, 127(2), 623-634 (2017-01-18)
Congenital tufting enteropathy (CTE) is a severe autosomal recessive human diarrheal disorder with characteristic intestinal epithelial dysplasia. CTE can be caused by mutations in genes encoding EpCAM, a putative adhesion molecule, and HAI-2, a cell surface protease inhibitor. A similar
Chuan-Jin Wu et al.
Cells, 9(4) (2020-04-25)
The homologs EpCAM and TROP2, which both interact with claudin-1 and claudin-7, are frequently coexpressed in epithelia including skin. Intestine uniquely expresses high levels of EpCAM but not TROP2. We previously identified EpCAM as a substrate of the membrane-anchored protease
Makiko Kawaguchi et al.
The American journal of pathology, 185(6), 1610-1623 (2015-04-07)
Hepatocyte growth factor activator inhibitor type 1 (HAI-1; official symbol SPINT1) is a membrane-associated serine proteinase inhibitor abundantly expressed in epithelial tissues. Genetically engineered mouse models demonstrated that HAI-1 is critical for epidermal function, possibly through direct and indirect regulation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico