Saltar al contenido
Merck

EHU011891

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF168

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TATCTCGGCTTCTCCCTTGAATTCCAGAAAATCTGATCCAGTTACACCCAAGTCTGAAAAGAAAAGTAAGAACAAACAAAGAAACACTGGAGATATTCAGAAGTATTTGACACCGAAATCTCAGTTTGGGTCAGCCTCACACTCTGAAGCTGTACAAGAAGTCAGGAAAGACTCCGTATCTAAGGACATTGACAGTAGTGATAGGAAAAGCCCAACAGGGCAAGACACAGAAATAGAAGATATGCCGACACTTTCTCCACAGATATCCCTTGGAGTTGGAGAACAAGGTGCAGATTCTTCAATAGAGTCCCCTATGCCATGGTTATGTGCCTGTGGTGCCGAATGGTACCATGAAGGAAACGTCAAAACAAGACCAAGCAATCATGGGAAAGAGTTATGTGTCTTAAGTCACGAGCGACCTAAAACCAGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Stanimir Dulev et al.
Cell cycle (Georgetown, Tex.), 19(1), 15-23 (2019-11-26)
The DNA damage response (DDR) associated post-translational modifications recruit chromatin remodelers, signaling proteins such as 53BP1 and repair factors to chromatin flanking DNA double strand breaks (DSBs) to promote its repair. Although localization of both RNF168 ubiquitin ligase and SET8
Parasvi S Patel et al.
The Journal of clinical investigation, 131(3) (2021-02-03)
Germline mutations in BRCA1 and BRCA2 (BRCA1/2) genes considerably increase breast and ovarian cancer risk. Given that tumors with these mutations have elevated genomic instability, they exhibit relative vulnerability to certain chemotherapies and targeted treatments based on poly (ADP-ribose) polymerase

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico