Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU010941

Sigma-Aldrich

MISSION® esiRNA

targeting human CYBB

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTTGTGGCTGTGATAAGCAGGAGTTTCAAGATGCGTGGAAACTACCTAAGATAGCGGTTGATGGGCCCTTTGGCACTGCCAGTGAAGATGTGTTCAGCTATGAGGTGGTGATGTTAGTGGGAGCAGGGATTGGGGTCACACCCTTCGCATCCATTCTCAAGTCAGTCTGGTACAAATATTGCAATAACGCCACCAATCTGAAGCTCAAAAAGATCTACTTCTACTGGCTGTGCCGGGACACACATGCCTTTGAGTGGTTTGCAGATCTGCTGCAACTGCTGGAGAGCCAGATGCAGGAAAGGAACAATGCCGGCTTCCTCAGCTACAACATCTACCTCACTGGCTGGGATGAGTCTCAGGCCAATCACTTTGCTGTGCACCATGATGAGGAGAAAGATGTGATCACAGGCCTGAAACAAAAGACTTTGTATGGACGGCCCAACTGGGATAATGAATTCAAGACAATTGCAAGTCAACACCCTAATACCAGAATAGGAGTTTTCCTCTGTGGACCTGAAGC

Ensembl | human accession no.

ENSG00000165168

NCBI accession no.

NM_000397

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CYBB(1536) , CYBB(1536)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wenjun Wang et al.
Brain research bulletin, 160, 141-149 (2020-05-12)
Sleep deprivation (SD) can induce cognitive and memory impairments. This impairment is in part due to oxidative stress damage in the hippocampus region of the brain. Corilagin (CL), a polyphenol belonging to the tannin family and extracted from Terminalia chebula
Young-Mee Kim et al.
American journal of physiology. Cell physiology, 312(6), C749-C764 (2017-04-21)
Reactive oxygen species (ROS) derived from NADPH oxidase (NOX) and mitochondria play a critical role in growth factor-induced switch from a quiescent to an angiogenic phenotype in endothelial cells (ECs). However, how highly diffusible ROS produced from different sources can
Xianzhang Zeng et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(2), 783-797 (2018-10-15)
Peri-operative cerebral ischemia reperfusion injury is one of the most serious peri-operative complications that can be aggravated in patients with diabetes. A previous study showed that microglia NOX2 (a NADPH oxidase enzyme) may play an important role in this process.
Yongpan Huang et al.
Oxidative medicine and cellular longevity, 2020, 3912173-3912173 (2020-12-05)
Oxymatrine (OMT) is the major quinolizidine alkaloid extracted from the root of Sophora flavescens Ait and has been shown to exhibit a diverse range of pharmacological properties. The aim of the present study was to investigate the role of OMT
Christopher R Marlein et al.
Blood, 130(14), 1649-1660 (2017-07-25)
Improvements in the understanding of the metabolic cross-talk between cancer and its microenvironment are expected to lead to novel therapeutic approaches. Acute myeloid leukemia (AML) cells have increased mitochondria compared with nonmalignant CD34
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico