Saltar al contenido
Merck

EHU009271

Sigma-Aldrich

MISSION® esiRNA

targeting human PPM1D

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTGTCAGAGCTGTGGAGGTGACACAGGACCATAAGCCAGAACTTCCCAAGGAAAGAGAACGAATCGAAGGACTTGGTGGGAGTGTAATGAACAAGTCTGGGGTGAATCGTGTAGTTTGGAAACGACCTCGACTCACTCACAATGGACCTGTTAGAAGGAGCACAGTTATTGACCAGATTCCTTTTCTGGCAGTAGCAAGAGCACTTGGTGATTTGTGGAGCTATGATTTCTTCAGTGGTGAATTTGTGGTGTCACCTGAACCAGACACAAGTGTCCACACTCTTGACCCTCAGAAGCACAAGTATATTATATTGGGGAGTGATGGACTTTGGAATATGATTCCACCACAAGATGCCATCTCAATGTGCCAGGACCAAGAGGAGAAAAAATACCTGATGGGTGAGCATGGACAATCTTGTGCCAAAATGCTTGTG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhong-Wu Lu et al.
Oncology reports, 43(3), 783-794 (2020-01-11)
Endeavors towards identifying key molecular markers for early diagnosis and treatment are driving the clinical study of papillary thyroid carcinoma (PTC). Recent studies have indicated that protein phosphatase, Mg2+/Mn2+ dependent, 1D (PPM1D) exerts an oncogenic function by increasing cell proliferation, migration
Chen Chen et al.
Journal of Cancer, 11(11), 3216-3224 (2020-04-02)
Accumulated studies showed that numerous microRNAs (miRNAs) were aberrantly expressed in human intrahepatic cholangiocarcinoma (ICC) and contributed to the tumorigenic processes. However, whether miR-129-2-3p is implicated in the ICC initiation and progression is still limited. Here, the results revealed that
Shigeo Ohba et al.
Cell reports, 31(2), 107518-107518 (2020-04-16)
The metabolic enzyme phosphoglycerate mutase 1 (PGAM1) is overexpressed in several types of cancer, suggesting an additional function beyond its established role in the glycolytic pathway. We here report that PGAM1 is overexpressed in gliomas where it increases the efficiency
Jin Ju Park et al.
Technology in cancer research & treatment, 19, 1533033820964425-1533033820964425 (2020-10-24)
Several techniques have been employed for deletion of the NKX3.1 gene, resulting in developmental defects of the prostate, including alterations in ductal branching morphogenesis and prostatic secretions as well as epithelial hyperplasia and dysplasia. To investigate whether the CRISPR/Cas9-mediated technique
Dong-Seok Park et al.
EMBO reports, 21(5), e48693-e48693 (2020-02-28)
The tumor suppressor Smad4, a key mediator of the TGF-β/BMP pathways, is essential for development and tissue homeostasis. Phosphorylation of Smad4 in its linker region catalyzed by the mitogen-activated protein kinase (MAPK) plays a pivotal role in regulating its transcriptional

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico