Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU007531

Sigma-Aldrich

MISSION® esiRNA

targeting human CDCA5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATCTTGAAAACGGAGCTGGATGAGTGGGCTGCGGCCATGAATGCCGAGTTTGAAGCTGCTGAGCAGTTTGATCTCCTGGTTGAATGAGATGCAGTGGGGGGTGCACCTGGCCAGACTCTCCCTCCTGTCCTGTACATAGCCACCTCCCTGTGGAGAGGACACTTAGGGTCCCCTCCCCTGGTCTTGTTACCTGTGTGTGTGCTGGTGCTGCGCATGAGGACTGTCTGCCTTTGAGGGCTTGGGCAGCAGCGGCAGCCATCTTGGTTTTAGGAAATGGGGCCGCCTGGCCCAGCCACTCACTGGTGTCCTGTCTCTTGTCGTCCTGTCCTTCCTATCTCCCCAAAGTACCATAGCCAGTTTCCAGATGGGCCACAGACTGGGGAGGAGAATCAGTGGCCCAGCCAGAAGTTAAAGGGCTGAGGGTTGAGGTGAGAG

Ensembl | nº de acceso humano

ENSG00000146670

Nº de acceso NCBI

NM_080668

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CDCA5(113130) , CDCA5(113130)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
FQR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chun-Jie Huang et al.
In vitro cellular & developmental biology. Animal, 53(3), 258-264 (2016-11-09)
Maintenance and timely termination of cohesion on chromosomes ensures accurate chromosome segregation to guard against aneuploidy in mammalian oocytes and subsequent chromosomally abnormal pregnancies. Sororin, a cohesion stabilizer whose relevance in antagonizing the anti-cohesive property of Wings-apart like protein (Wapl)
Jianlin Wang et al.
Oncology reports, 40(4), 1875-1884 (2018-07-18)
Cell division cycle associated 5 (CDCA5) has been associated with the progression of several types of cancers. However, its possible role and mechanism in hepatocellular carcinoma (HCC) remain unknown. In the present study, immunohistochemical staining and real‑time PCR were used to
Tatsuya Kato et al.
International journal of oncology, 49(6), 2411-2420 (2016-11-15)
Malignant pleural mesothelioma (MPM) is an aggressive type of cancer of the thoracic cavity commonly associated with asbestos exposure and a high mortality rate. There is a need for new molecular targets for the development of more effective therapies for

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico