Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU005981

Sigma-Aldrich

MISSION® esiRNA

targeting human EPS8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAATGGCTACGGATCATCACCTACCTTTTCCCAGACGGACAGAGAACATGGTTCAAAAACAAGTGCAAAGGCCCTTTATGAACAAAGGAAGAATTATGCACGGGACAGTGTCAGCAGTGTGTCAGATATATCTCAATACCGTGTTGAACACTTGACTACCTTTGTCCTGGATCGGAAAGATGCTATGATCACTGTTGATGATGGAATAAGGAAATTGAAATTGCTTGATGCCAAGGGCAAAGTGTGGACTCAAGATATGATTCTTCAAGTGGATGACAGAGCTGTGAGCCTGATTGATTTAGAATCAAAGGCAAGTAATGAACTGGAGAATTTTCCTTTAAACACAATCCAGCACTGCCAAGCTGTGATGCATTCATGCAGCTATGATTCAGTTCTTGCACTGGTGTGCAAAGAGCCAACCCAGAACAAGCCAGAT

Ensembl | human accession no.

ENSG00000151491

NCBI accession no.

NM_004447

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... EPS8(2059) , EPS8(2059)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jieyun Zhang et al.
Acta biochimica et biophysica Sinica, 52(3), 259-267 (2020-03-10)
Tumor metastasis is the main cause of treatment failure and death in patients with late stage of gastric cancer (GC). Studies showed that microRNAs (miRNAs) are important regulators in the process of tumor metastasis. In this study, we used miRNA
Huifang Lu et al.
Molecular medicine reports, 14(6), 4999-5006 (2016-11-15)
Epidermal growth factor receptor pathway substrate 8 (EPS8) is critical in the proliferation, progression and metastasis of solid and hematological types of cancer, and thus constitutes an ideal target for cancer immunotherapy. The present study aimed to identify human leukocyte antigen
Haruhi Fukuhisa et al.
Journal of human genetics, 64(6), 521-534 (2019-03-13)
Our ongoing analyses identifying dysregulated microRNAs (miRNAs) and their controlled target RNAs have shed light on novel oncogenic pathways in pancreatic ductal adenocarcinoma (PDAC). The PDAC miRNA signature obtained by RNA sequencing showed that both strands of pre-miR-130b (miR-130b-5p, the
Quan Yuan et al.
International journal of pharmaceutics, 557, 178-181 (2019-01-01)
We developed polyamidoamine dendrimers conjugated with epidermal growth factor (EGF) for use in receptor-mediated delivery of therapeutics to cancer cells. Here, we demonstrate the utility of this approach to inhibit proliferation and migration of head and neck squamous carcinoma cells
Elisa Cappellini et al.
Life sciences, 131, 30-36 (2015-04-22)
Eps8 is an actin-binding protein which has been proposed as a regulator of cancer cell motility and invasion. However, nothing much is known about its contribution to the invasive properties of endothelial cells (ECs), and more generally to angiogenesis. Expression

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico