Saltar al contenido
Merck

EHU004281

Sigma-Aldrich

MISSION® esiRNA

targeting human IDH2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Fecha estimada de envío16 de mayo de 2025



Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Fecha estimada de envío16 de mayo de 2025


descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCCCATCATCTGCAAAAACATCCCACGCCTAGTCCCTGGCTGGACCAAGCCCATCACCATTGGCAGGCACGCCCATGGCGACCAGTACAAGGCCACAGACTTTGTGGCAGACCGGGCCGGCACTTTCAAAATGGTCTTCACCCCAAAAGATGGCAGTGGTGTCAAGGAGTGGGAAGTGTACAACTTCCCCGCAGGCGGCGTGGGCATGGGCATGTACAACACCGACGAGTCCATCTCAGGTTTTGCGCACAGCTGCTTCCAGTATGCCATCCAGAAGAAATGGCCGCTGTACATGAGCACCAAGAACACCATACTGAAAGCCTACGATGGGCGTTTCAAGGACATCTTCCAGGAGATCTTTGACAAGCACTATAAGACCGACTTCGACAAGAATAAGATCTGGTATGAGCACCGGCTCATTGATGACATGGTGGCTCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bonnie H Y Yeung et al.
American journal of respiratory cell and molecular biology, 63(1), 36-45 (2020-03-10)
Global DNA hydroxymethylation mediated by the TET (ten-eleven translocation) enzyme was induced in allergen-induced airway hyperresponsiveness in mouse lung tissues and specifically in isolated airway smooth muscle (ASM) cells. TET is an α-ketoglutarate (α-KG)-dependent enzyme, and the production of α-KG
Su-Jeong Choi et al.
Biochemical and biophysical research communications, 503(3), 1805-1811 (2018-08-04)
Isocitrate dehydrogenase 2 (IDH2) is an essential enzyme in the mitochondrial antioxidant system, which produces nicotinamide adenine dinucleotide phosphate, and thereby defends against oxidative stress. We have shown that IDH2 downregulation results in mitochondrial dysfunction and reactive oxygen species (ROS)
Fen Gong et al.
Biochemical and biophysical research communications, 514(3), 593-600 (2019-05-09)
Nonalcoholic fatty liver disease (NAFLD) has become an epidemic across the world. A large and growing unmet therapeutic requirement has inspired plenty exploration in the field. Isocitrate dehydrogenase 2 (IDH2), localized in mitochondria, decreases NADP+ to NADPH during the decarboxylation

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico