Saltar al contenido
Merck

EHU001391

Sigma-Aldrich

MISSION® esiRNA

targeting human TMEM131

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGTCCAAGGACAAGGAACAACTGAGAACTTGAGGGTGGCAGGCAAGCTTCCAGGTCCAGGAAGCTCCTTACGCTTTAAAATCACGGAAGCATTGTTAAAAGATTGTACAGATAGTTTAAAACTAAGAGAACCAAATTTCACATTGAAAAGAACATTTAAGGTAGAGAATACAGGACAACTTCAAATTCACATAGAAACCATTGAAATCAGTGGATACTCATGTGAAGGATATGGCTTTAAAGTTGTTAATTGTCAAGAGTTTACTCTAAGTGCCAATGCTTCTAGAGATATAATCATATTGTTTACTCCTGATTTTACAGCTTCTAGAGTTATTCGGGAACTGAAGTTTATAACAACCAGTGGCTCTGAGTTTGTATTTATATTGAATGCATCCCTTCCTTACCATATGTTAGCAACCTGTGCAGAAGCCCTACCCAGACCT

Ensembl | nº de acceso humano

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chao Wang et al.
Journal of cellular biochemistry, 119(2), 1646-1658 (2017-08-05)
The study elucidated the effects associated with silencing growth factor-β R1 (TGF-β R1) and TGF-β R2 genes on the proliferation and apoptosis of penile urethral epithelial cells (UECs) in hypospadiac male rats. Seventy-five male rats were distributed into the normal
Karl E Carlström et al.
Nature communications, 11(1), 4071-4071 (2020-08-15)
Arrest of oligodendrocyte (OL) differentiation and remyelination following myelin damage in multiple sclerosis (MS) is associated with neurodegeneration and clinical worsening. We show that Glutathione S-transferase 4α (Gsta4) is highly expressed during adult OL differentiation and that Gsta4 loss impairs
Yanjie Zhang et al.
Ecotoxicology and environmental safety, 179, 222-231 (2019-05-03)
Hydrogen sulfide (H2S), a multifunctional gasotransmitter, participates in a wide range of cellular signal transduction and pathophysiological processes. Cystathionine gamma-lyase (CSE) acts as a major H2S-generating enzyme in peripheral organs and tissues. As a cysteine-rich and heavy metal-binding protein, metallothionein-1
Yanjie Zhang et al.
Antioxidants & redox signaling, 32(9), 583-601 (2019-12-25)
Aims: The physiological and pathological importance of hydrogen sulfide (H2S) as a novel gasotransmitter has been widely recognized. Cystathionine
Yoav Elkis et al.
Nature communications, 8(1), 940-940 (2017-10-19)
Disruption of the reprogrammed energy management system of malignant cells is a prioritized goal of targeted cancer therapy. Two regulators of this system are the Fer kinase, and its cancer cell specific variant, FerT, both residing in subcellular compartments including

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico